Sentences with phrase «of nucleotide bases»

They can copy only certain sequences of nucleotide bases, the building blocks that make up RNA and DNA, and those sequences don't carry out any important function inside cells.

Biochemist Nirenberg of the National Institutes of Health gave a seminar describing a groundbreaking experiment in which he and a colleague had discovered how the cell interprets messenger RNA — by reading one triplet, or codon, of nucleotide bases at a time — to line up the amino acids that form proteins.

The genetic blueprints are encoded in the sequence of nucleotide bases.

The Human Genome Project, which sequenced the 3 billion pairs of nucleotide bases in human DNA, was a piece of cake in comparison: Epigenetic markers and patterns are different in every tissue type in the human body and also change over time.

DNA consists of certain basic building blocks, each consisting of a nucleotide base, a sugar, and a phosphate group.

Occasionally, though, one of the nucleotide base pairs that make up the molecule gets switched, or a short stretch of genetic code is duplicated.

It will then test the device to see if it is possible to distinguish between the four types of nucleotides based on differences in a phenomenon called electron tunneling.

«By combining different methods for RNA sequencing with new bioinformatics tools we could find novel sites of nucleotide base exchange, so - called editing», says Jens Lagergren, Professor at the Royal Institute of Technology and group leader at SciLifeLab Stockholm.

Without the hydrogen bonds of their nucleotide base pairs holding them together, they will repel and break apart.

The DNA replication of these types of cells requires nucleotides from dietary sources, and hence the positive response to the use of our nucleotide based products.

Not exact matches

The interaction of the reagents then proceeded until the number of nucleotide units (consisting of a base, deoxyribose and a phosphate) polymerized was exactly equal to the number of nucleotides in the template DNA.

The current standard of care for HCV genotype 3 is the nucleotide polymerase inhibitor sofosbuvir with weight - based RBV for 24 weeks.

A genome consists of only four different nucleotide bases, or DNA subunits, arranged in a particular sequence.

That sort of resolution should be good enough to determine the sequence of all the nucleotide bases in the human genetic code.

It is based on the design of a small RNA (RNAsg) that is complementary and specific to a 20 nucleotide DNA region.

DNA is made of four substances — the nucleotide bases adenine, guanine, thymine, and cytosine — that will combine only in specific configurations and sequences.

The team found that a mutation in a single pair of nucleotides in the gene causes seed coat permeability — that is, a change in one pair out of the approximately 1 billion base pairs that make up the soybean genome.

To explore the mechanism of this reaction, we screened for nucleotides in Escherichia coli 23S rRNA that may have a perturbed pK a (whereK a is the acid constant) based on the pH dependence of dimethylsulfate modification.

Then they induced a single, 12 - base strand of DNA from the human p53 gene to build a complementary copy of itself out of the modified nucleotides.

One commercially available alternative is pyrosequencing, which also detects nucleotides as they are added to a single strand of DNA, but it can lead to errors because it is harder to differentiate between a single base and a whole stretch of identical bases next to each other, says Elaine Mardis, a geneticist at Washington University in St Louis, US.

These results are consistent with a mechanism wherein the nucleotide base of A2451 serves as a general acid base during peptide bond formation.

The model shows the classic double helix of DNA strands going in opposite directions with nucleotides linking to each other across the strands to form base pairs.

All of these studies were genome - wide association studies (GWAS) based on millions of genetic variants called Single Nucleotide Polymorphisms (SNPs).

However, based on data now available, we see that the sequence of the 3 billion nucleotides in any individual genome is unique in comparison with the sequence of another individual's genome, while the degree of sequence similarity between the 3 billion nucleotides in any two genomes is remarkably high.

Smith's group substituted one of the probe's bases with 3 - nitropyrrole, a molecule that is shaped like a nucleotide but that doesn't bind to one on an opposite strand.

Then, in 2010, Pääbo and colleagues published a draft sequence of the Neanderthal's nuclear genome — 4 billion nucleotides — based on three individuals.

The sugars are bound together by the phosphate groups, forming the backbone of the DNA, and each sugar has a nucleotide base attached to it.

For the analyses, Thompson and his colleagues looked for single - letter (nucleotide base) changes in DNA that correspond to the sizes of key brain regions.

Some of the differences among studies could arise from gene tree incongruence, possibly due to incomplete lineage sorting (ILS) of those genes (29, 31), nucleotide base composition biases (19), differences between data types (32, 33), or insufficient data (34, 35).

The current methods for synthesizing genes, he said, either limit the length of a gene to about 200 base pairs — the sets of nucleotides that made up DNA — or are prohibitively expensive for most labs.

We have determined at 2.1 angstrom resolution the crystal structure of a T7 RNAP elongation complex with 30 base pairs of duplex DNA containing a «transcription bubble» interacting with a 17 - nucleotide RNA transcript.

When molecular hydrogen (H2), methane (CH4), ammonia (NH3) and water (H20) are mixed together in the presence of virtually any intermittent source of energy capable of breaking chemical bonds, the result is a remarkably high yield of amino acids and the sugars and nitrogenous bases that are the chemical constituents of the nucleotides.

The human genome contains about 3 billion base pairs, but only about 2 percent of these base pairs represent protein - coding genes, meaning that whole - exome sequencing measures the genetic alterations focused on a small but very important fraction of the genome (as opposed to techniques of whole genome sequencing, which measures every nucleotide across the entire genome, regardless of whether these genes are expressed or silent).

To study natural selection, the team combed the International Haplotype Map for long stretches of DNA flanked by a single nucleotide polymorphism (SNP, or «snip»)-- that is, an altered base, or «letter,» in the genetic alphabet.

With their DNA Fountain technique, Erlich and Zielinski pack an average of 1.6 bits into each base nucleotide.

The capacity of DNA data - storage is theoretically limited to two binary digits for each nucleotide, but the biological constraints of DNA itself and the need to include redundant information to reassemble and read the fragments later reduces its capacity to 1.8 binary digits per nucleotide base.

The most commonly used form of Cas9, derived from the bacteria Streptococcus pyogenes and known as SpCas9, recognizes PAM sequences in which any nucleotide is followed by two guanine DNA bases.

Working with French composer Richard Krüll, the pair turned the complete nucleotide sequences of several microbe genes into compositions based on DNA bases: A (adenosine), C (cytosine), G (guanine), and Thymine (which they have translated to «Re,» or D).

Gregory Koblentz, deputy director of the biodefense program at George Mason University in Fairfax, Virginia, speculates that the FBI may have used a recent technique based on the identification of Single - Nucleotide Repeat markers in the anthrax genome that allows for differentiating between variants of the same strain.

The technique of DNA origami capitalizes on the simple base - pairing properties of DNA, a molecule built from the four nucleotides Adenine (A), Thymine (T) Cytosine (C) and (Guanine).

Previous genetic studies have examined the association of aspirin, NSAIDs, or both with colorectal cancer according to a limited number of candidate genes or pathways.6 - 10 Thus, to comprehensively identify common genetic markers that characterize individuals who may obtain differential benefit from aspirin and NSAIDs, we conducted a discovery - based, genome - wide analysis of gene × environment interactions between regular use of aspirin, NSAIDs, or both and single - nucleotide polymorphisms (SNPs) in relation to risk of colorectal cancer.

Base - pairing of complementary nucleotides causes the form to fold and self - assemble.

Nucleotide sequence of first 1000 bases of HIV - 1 strain HXB2 provirus.

Large - scale resequencing of the first ESTs and subsequent genotyping of single nucleotide polymorphisms in large populations expanded the available molecular marker resources and provided a basis for examining their association with traits of interest (Eckert et al. 2013).

Bloom and Jacobs say that, to their knowledge, GTC has only sequenced 40 000 of the 4 million nucleotide bases that make up the M. tuberculosis genome.

Based on the nucleotide context, the authors suggest that a new mutational mechanism may be at work involving cytosine deamination of single - stranded DNA (presumably during replication).

Abbreviations: bp, base pair; CS, Cockayne syndrome; E [number], embryonic day [number]; kb, kilobase; NER, nucleotide excision repair; SEM, standard error of the mean; TFIIH, basal transcription / DNA repair factor IIH; TTD, trichothiodystrophy; UV - RRS, recovery of RNA synthesis after ultraviolet irradiation; UV - UDS, unscheduled DNA synthesis after ultraviolet irradiation; wt, wild - type; XP, xeroderma pigmentosum; XPCS, xeroderma pigmentosum combined with Cockayne syndrome; XPTTD, combination xeroderma pigmentosum and trichothiodystrophy

To obtain cDNA fragments of the kakusei homolog in Japanese honeybee, PCR was performed using a set of primers designed based on the nucleotide sequence of the European honeybee kakusei, 5 ′ - GGGGAAGCCAGGAGCCGCGGGTTTACAT - 3 ′ and 5 ′ - AGGCAACAGCACACCATGGGCCTTGGAT - 3 ′, with Ex Taq (Takara, Tokyo, Japan).

Take any organism on earth, and its DNA and RNA have four nucleotide bases, or letters (usually abbreviated as A, T, C and G in DNA; in RNA, another base, U, takes the place of T).

The DNA in a cell is really just a pattern made up of four different parts, called nucleotides or bases.