Sentences with phrase «of primer first»

If we had to paint over bright or darker colors, I'd consider a coat of primer first, especially depending on the paint brand you use.

I just made sure to use a couple good coats of primer first!

If you are using regular latex paint, you will likely need to sand and use a boat of primer first.

Be sure to sand down the wood and use 2 coats of primer first)

If you want your furniture to have a smooth, non-distressed finish, I would definitely apply a coat of primer first, but if you're going for the chipped paint look, go ahead and skip the primer!

In a nutshell, YES you can use chalk paint in a paint sprayer, but use a coat of PRIMER first.

Not exact matches

For those who don't often discuss characterization and story world over dinner, Weinschenk's post kicks off with a great primer on storytelling theory, explaining the basics of Campbell's thinking (famously exemplified by the journey of Star Wars» Luke Skywalker), as well as the roughly bell - shaped story diagram every writer learns in her first class on structure.

His panel included Kamo Asatryan, co-founder and CEO of Primer; Andrew First, co-founder and CTO of leanplum; Ankit Jain, VP product, SimilarWeb.

In previous installments of this primer I've tried to convince you, first, that monetary policy is ultimately about keeping the available quantity of money from differing substantially, if only temporarily, from the quantity demanded and, second, that doing this boils down in practice to having a money...

As we did last year, we would like to offer you this first report of 2015 as a primer to what may be next for us in the global wine business.

A 2004 «Chile Pepper Primer» published in the Albuquerque weekly Alibi, citing the Chile Pepper Institute, reported, «In 1907 Fabian Garcia was finally able to release his first standardized New Mexican pod type... the granddaddy of all future New Mexico pod types.»

The first section of the book is a nutrition primer, and the rest of it is filled with recipes (many of them vegetarian) designed specifically to boost your health, and your baby's.

She is the author the book, Revising Flannery O'Connor: Southern Literary Culture and the Problem of Female Authorship, a project that was one of the first recipients of the National Endowment for the Humanities Dissertation Grant, and of the white paper commissioned by the International Cesarean Awareness Network, «Protecting and Enforcing the Rights of Women Seeking Vaginal Birth after Cesarean (VBAC): A Primer.»

Though Simkin is a respected midwife and natural birth advocate, this text is written in an unbiased way and is a great primer for the first time parent, no matter what kind of birth they are planning on having.

This presentation provides a primer on assessing milk adequacy during the first week of life, the need for supplements, and when supplements are needed, recommended feeding volumes and methods.

In a short book - the first in a series in which National Academy of Science members will describe their science and research for general audiences - the author offers a concise primer on the brain and its development.

Because no kakusei homolog had been identified in any other animal species, including insects, however, we first amplified parts of kakusei cDNA from the Japanese honeybee using primers designed from the European honeybee kakusei cDNA sequences.

Another milestone I can attribute to the HapMap Project was my first first - author paper, Distribution of human SNPs and its effect on high - throughput genotyping, one of the first studies to highlight the connection between nearby SNPs (in primer sites) and genotyping assay failure (including allele dropout).

The first one is to strengthen the sample RNA using a combination of enzymes and so - called «primers.»

Ten microliters of a l / 1000 dilution of the first - round PCR product was employed as a template in a second PCR using PB (5 ′ - CGTACTGGAAAGTGCGGCTG - 3 ′) as the forward primer and P97 (5 ′ - GATGTTCAACTCATCCTGGTCCC - 3 ′) as the reverse primer [19].

Primers CT - C, CT - G, CT - N6, and CT - L were designed based on sequence results to eliminate base error introduced by the first set of pPrimers CT - C, CT - G, CT - N6, and CT - L were designed based on sequence results to eliminate base error introduced by the first set of primersprimers.

Next, 5 µl of the transcribed cDNA were used for the first round of PCR amplification with primers 419F (5 ′ - ATCAGTTAACCTACCCGAGTCGGAC - 3 ′) and 1154R (5 ′ - GCCGCCTCTTCTTCATTGTTCTC - 3 ′)[14] and HotStart - IT FideliTaq Master Mix (USB) with the recommended component volumes.

Nested PCR was performed under the same conditions for 45 amplification cycles with 5 µl of the first round PCR product and two different primer pairs, Gag - I - F (5 ′ - TCTCGAGATCATGGGACAGA - 3 ′) and Gag - I - R (5 ′ - AGAGGGTAAGGGCAGGGTAA - 3 ′) or NP116 (5 ′ - CATGGGACAGACCGTAACTACC - 3 ′) and NP117 (5 ′ - GCAGATCGGGACGGAGGTTG - 3 ′), respectively, both of which have been shown to detect both XMRV and MLV gag sequences [13].

The resulting first strand cDNA products were poly G - tailed followed by 30 rounds of PCR amplification using a single primer.

Subsequently, equal amounts of total RNA (300 - 500 ng) were reverse transcribed into cDNA using random primers (SuperScript First Strand Synthesis for RT - PCR; Invitrogen, Carlsbad, CA).

Prep lids first Before applying shadow, tap a small dab of foundation or eye shadow primer - try Urban Decay Eye Shadow Primer Potion ($ 18; sephora.com)- from lash lines to crprimer - try Urban Decay Eye Shadow Primer Potion ($ 18; sephora.com)- from lash lines to crPrimer Potion ($ 18; sephora.com)- from lash lines to creases.

Cameron's first tome, The Body Book, was a primer for how to eat and move for total wellness, with a blend of science and holistic health.

A basic digestion primer The first, most important thing to understand about nutrition is HOW what you consume is getting into your body, which is the purpose of this first installment.

Because the delicate — read: thin — skin around your eyes is one of the first areas of your body to fall victim to premature signs of aging, using an anti-aging eyeshadow primer can be like wearing an anti-aging eye cream all day long.

I do use a tiny bit of the Urban Decay eyeshadow Primer first, as my eyelids can be a little oily sometimes.

That first stroke of primer must have been really scary... the results are wonderful.

Okay so first of all, I'm going to say that I have not found much luck with primers and have instead opted to not use them anymore.

Emulate Pà © nelope's sultry Arabesque eyes by first dabbing and blending Out of Space Balm by HIRO Cosmetics all over the eyelid — it acts as a primer and concealer.

First, I did a couple coats of Zinsser primer and then a couple coats of Annie Sloan Chalk Paint in Old Ochre.

I was told by one of the Ace Hardware employees that this paint was a paint and primer in one so not to buy a primer, however, I would advise just always priming first.

The chest of drawers was painted with a thick coat of Primer Red first, and then Lem Lem.

They are one of the UK leading Makeup brands and the Porefessional matte rescue is their second primer; the first one being the Porefessional face primer.

At first I planned on getting Radiance instead of the Hydrating primer but I'm glad I got the Hydrating one.

Korres Vitamin E Silicone - Free Face Primer — This is one of the very first products I discovered out of this list that truly helped prevent breakouts.

It looks especially good when you use a primer first and add a light coating of powder after applying.

The first products the guys introduced me to were the Photo Finish Primer Water to prep and refresh the skin and the Photo Finish Oil Primer, which is a primer formulated as a lightweight facial oil to reduce the appearance of fine lines and increase moiPrimer Water to prep and refresh the skin and the Photo Finish Oil Primer, which is a primer formulated as a lightweight facial oil to reduce the appearance of fine lines and increase moiPrimer, which is a primer formulated as a lightweight facial oil to reduce the appearance of fine lines and increase moiprimer formulated as a lightweight facial oil to reduce the appearance of fine lines and increase moisture.

# 1 Illuminating Primer: First I used a pea size amount of Laura Mercier's Foundation Primer in Radiance all over my face.

Just like your common eye and foundation primers, the eyelash primer prepares the lash to receive the mascara and offers some of the same benefits: even application, longer lasting effect, prevent smudge and clumping and less product absorption on your lashes; it also protects your strands from drying with the constant use of mascara, so if you use it on a daily basis, applying a first a primer is the best option to protect your lashes.

Makeup details: Primer: Charlotte Tilbury Foundation: Estēe Lauder Blush: Bobbi Brown Bronzer: Tom Ford Highlighter: Stila Powder: Urban Decay Eyeshadow: Urban Decay Eyeliner: Charlotte Tilbury Eyelashes: MAC Lip: Urban Decay «Backtalk» Outfit details: Dress: Nordstrom Earrings: Baublebar Heels: Sam Edelman With tomorrow being the first official day of spring (even though it has felt like spring for weeks now), I thought I'd share my current favorite spring beauty...

By Robin 31 Comments Filed Under: All Things Behr Paint Tagged With: beachy colors, Behr Ultra Paint with Primer, changing colors in your house, color, DIY projects, first project of 2011, painting furniture, painting the inside of the house, pastel cottage, pastels, shabby chic

For the first time in my life, I have filled in my brows, discovered primer and am beginning to finally get the hang of liquid liner.

Smooth a drop of makeup primer on your skin first (it'll help the foundation stay put), then do one light dusting of the powder.

Also it says this product is a makeup primer, first of all it does nt dry!

I'm more on the oily side so I was skeptical of trying it on but I still did first day i tried it on with the primer and the second day the foundation alone and it was perfect with the primer it last long, it didn't move around, and my face wasn't greasy.

Odd at first, you have to think of it as the SPF version of the lavender face primers you see everywhere, adding radiance to an otherwise dull face and toning down redness.