Sentences with phrase «of primer set»

The gene expression from every sample was amplified in triplicates, with a single volume of 10 µl containing: 3 µl of diluted cNDA with 0.5 µl of primer set (see Table 1 for primer sequences), 1.5 µl double distilled water (DDW) and 5 µl of GoTaq qpcr Master Mix Kit (Promega, USA).

Not exact matches

The Peaches & Cream collection features a sweetie pie bronzer, a bronzed peach shade, various shades of peach kiss lipsticks, various shades of peach blush, a peach frosted highlighter, a peachy matte eyeshadow palette, a peach mist setting spray, a peach perfect foundation, a peach blur finishing powder, a primed and peachy primer & a peach perfect magnifying & setting powder.

Oh do nt forget that to anyone who actually knows something about the laws of physics and metallurgy, that in order to eliminate a large variance in repeatability, you will have to by law, dictate the material, and properties of the components for the firing pins, shell casings and primers for every single firearm made (designers and manufacturers set these material properties and types during design based on use and cost), since this or any other law does not, and it is so easy to beat, any claim to this being smart is f# # $ % $ # stupid.

They accompany a primer on SEM, explaining the basics of the technology, the types of signals that can be detected, and how these are applied today in a research setting.

Using PCR with a different set of short primers from Clark's, her findings seem to corroborate Clark's and Oliver's works: She has identified B. andersonii, B. americana and classic B. burgdorferi in lone star ticks and their close relatives Amblyomma cajennense, found from the U.S. / Mexican border down through South America.

The authors of this study have developed a universal primer set across flowering plants that amplifies 3 - 15 kilobase fragments, which can then easily be sequenced using recently developed next - generation sequencing technologies.

Changes in microbial assemblages were evaluated with a one - way analysis of similarity (Primer, ANOSIM) and multi dimensional scaling (MDS), based on Bray - Curtis similarities, which was performed on all samples sets, healthy, apparently healthy and diseased.

To obtain cDNA fragments of the kakusei homolog in Japanese honeybee, PCR was performed using a set of primers designed based on the nucleotide sequence of the European honeybee kakusei, 5 ′ - GGGGAAGCCAGGAGCCGCGGGTTTACAT - 3 ′ and 5 ′ - AGGCAACAGCACACCATGGGCCTTGGAT - 3 ′, with Ex Taq (Takara, Tokyo, Japan).

Amplification was performed with two sets of gene - specific primers for 5 ′ - RACE and 3 ′ - RACE.

The abundance of each barcoded clone can then be monitored over time by sequencing the barcodes in the population (all barcodes can be amplified using the same sets of forward and reverse primers).

mRNA expression of DDX3 and p21waf1 / cip1 in adjacent normal liver tissues and HCC samples was examined using quantitative real - time PCR (LightCycler FastStart DNA Master SYBR Green I, Roche Applied Science, Mannheim, Germany) according to the instruction manual using the primer set DDX3 - 4987F, TTCTCAGATGTTTGTTGTGTGGATT; DDX3 - 5142R, AAACTTGCTCAAATGCTATTGCTG; p21 - F, AATCCCAGCTACTTGGAAGGC; and p21 - R, GCTGACTGCAACCTCTGCC.

Primers CT - C, CT - G, CT - N6, and CT - L were designed based on sequence results to eliminate base error introduced by the first set of pPrimers CT - C, CT - G, CT - N6, and CT - L were designed based on sequence results to eliminate base error introduced by the first set of primersprimers.

Purified and diluted PCR amplicons and a set of six pre-diluted DNA standards are amplified by quantitative (qPCR) methods, using the KAPA SYBR ® FAST qPCR Master Mix and primers.

Each plate contained three technical replicates of every sample for each set of primers.

To prepare UAS overexpression constructs, the entire open reading frames of GBP1 and GBP2 were isolated by RT - PCR using cDNA made from w1118 wandering larvae with primer sets as described in S1 Table.

Tissue DNA was subjected to amplification of a region within the 5s - 23s ribosomal genes using a nested set of primers.

Depending on the region of JAK1 to be sequenced, different sets of primers were used to amplify and sequence JAK1 PCR product (available upon request).

A primer / probe set designed to detect 136 bases of the human β - globulin gene was amplified and detected simultaneously in the same reaction with XMRV pol sequence to control for specimen integrity and PCR efficiency.

Here are the products I used for this particular face: Face: MAC Prep + Prime Skin Primer MAC Studio Fix Fluid Foundation in NW10 Anastasia Beverly Hills Clear Brow Gel Anastasia Beverly Hills Beauty Express Brow Powder in Brunette Korres Zea Mays blush in Pink MAC powder blush in Taupe Benefit High Beam illuminator NYX Long Lasting Makeup Setting Spray in Matte Finish Eyes: MAC Longwear Paint Pot in Painterly NYX Jumbo Eye Pencil in Black Bean ipsy + NYX neutrals trio palette (all shades) Sonia Kashuk eyeshadow quad in Queen of the Blues (glitter shade, frosty blue shade) Urban Decay 24/7 Glide - on Eyeliner in Zero NYX Big and Loud lash primer Clarins Be Long mascara in Intense Black Lips: MAC Prep + Prime lip primer Obsessive - Compulsive Cosmetics Cosmetic Colour pencil in Anti-Feathered MAC Amplified lipstick in Saint Germain MAC Mineralizeglass lip gloss in BeautifulPrimer MAC Studio Fix Fluid Foundation in NW10 Anastasia Beverly Hills Clear Brow Gel Anastasia Beverly Hills Beauty Express Brow Powder in Brunette Korres Zea Mays blush in Pink MAC powder blush in Taupe Benefit High Beam illuminator NYX Long Lasting Makeup Setting Spray in Matte Finish Eyes: MAC Longwear Paint Pot in Painterly NYX Jumbo Eye Pencil in Black Bean ipsy + NYX neutrals trio palette (all shades) Sonia Kashuk eyeshadow quad in Queen of the Blues (glitter shade, frosty blue shade) Urban Decay 24/7 Glide - on Eyeliner in Zero NYX Big and Loud lash primer Clarins Be Long mascara in Intense Black Lips: MAC Prep + Prime lip primer Obsessive - Compulsive Cosmetics Cosmetic Colour pencil in Anti-Feathered MAC Amplified lipstick in Saint Germain MAC Mineralizeglass lip gloss in Beautifulprimer Clarins Be Long mascara in Intense Black Lips: MAC Prep + Prime lip primer Obsessive - Compulsive Cosmetics Cosmetic Colour pencil in Anti-Feathered MAC Amplified lipstick in Saint Germain MAC Mineralizeglass lip gloss in Beautifulprimer Obsessive - Compulsive Cosmetics Cosmetic Colour pencil in Anti-Feathered MAC Amplified lipstick in Saint Germain MAC Mineralizeglass lip gloss in Beautiful Moves

This 2 in 1 primer & setting spray with can be applied underneath or over the top of your makeup.

I also have reviews of my brighteners here, concealers here, neutralizers, primers, powders, setting sprays, foundation brushes, blushes, and highlighters, bronzers, brows, waterline liners, eye pencils, liquid liner, drugstore mascara, high end mascara, liquid lipsticks, Pore Minimizing Primers, & Illumiprimers, powders, setting sprays, foundation brushes, blushes, and highlighters, bronzers, brows, waterline liners, eye pencils, liquid liner, drugstore mascara, high end mascara, liquid lipsticks, Pore Minimizing Primers, & IllumiPrimers, & Illuminators.

So for this year's Best Beauty Buys, our panel of pros put all of the foundations, concealers, primers, and finishing powders to the test to find out which ones outlast the rest — plus the best products to help set them.

With primer and setting spray I can get 8 - 9 hours of wear at max, but without the effort the foundation does not last a full workday on me.

Though primer is one of the best ways (second to a setting spray) to keep a full face intact for hours on end, certain formulas tend to further dehydrate your skin, especially if it's already pretty dry to begin with.

Primer A great primer and setting spray will keep your makeup from slipping and sliding on the hottest ofPrimer A great primer and setting spray will keep your makeup from slipping and sliding on the hottest ofprimer and setting spray will keep your makeup from slipping and sliding on the hottest of days.

Juice Beauty Best of Phyto - Pigments Makeup + Brush Set, $ 75 — Juice Beauty makes some amazing natural and mineral based makeup, and their primer is one of my favorites.

Without added measures four to six hours, with primer, powder and setting spray a full work day of around ten hours.

I also have reviews of my brighteners here, concealers here, neutralizers, primers, powders, setting sprays, foundation brushes, blushes, and highlighters, bronzers, and brows.

I also have reviews of my brighteners here, concealers here, neutralizers, primers, powders, setting sprays, foundation brushes, blushes, highlighters, bronzers, brows, waterline liners, eye pencils, liquid liner, drugstore mascara, high end mascara, liquid lipsticks, Pore Minimizing Primers, Illuminators, stick foundations, powder foundations lip liners, drugstore lip glosses, high end lip glosses, gel / cream eye liners, dry shampoos, drugstore lipsticks, face Mists, eyeliner brushes, high end lipsticks, and serum foundprimers, powders, setting sprays, foundation brushes, blushes, highlighters, bronzers, brows, waterline liners, eye pencils, liquid liner, drugstore mascara, high end mascara, liquid lipsticks, Pore Minimizing Primers, Illuminators, stick foundations, powder foundations lip liners, drugstore lip glosses, high end lip glosses, gel / cream eye liners, dry shampoos, drugstore lipsticks, face Mists, eyeliner brushes, high end lipsticks, and serum foundPrimers, Illuminators, stick foundations, powder foundations lip liners, drugstore lip glosses, high end lip glosses, gel / cream eye liners, dry shampoos, drugstore lipsticks, face Mists, eyeliner brushes, high end lipsticks, and serum foundations.

I also have reviews of my brighteners here, concealers here, neutralizers, primers, powders, setting sprays, foundation brushes, blushes, and highlighters, bronzers, brows, waterline liners, eye pencils, and liquid liner.

I also have reviews of my brighteners here, concealers here, neutralizers, primers, powders, setting sprays, foundation brushes, blushes, highlighters, bronzers, brows, waterline liners, eye pencils, liquid liner, drugstore mascara, high end mascara, liquid lipsticks, Pore Minimizing Primers, Illuminators, stick foundations, powder foundations lip liners, drugstore lip glosses, high end lip glosses, gel / cream eye liners, dry shampoos, drugstore lipsticks and Faceprimers, powders, setting sprays, foundation brushes, blushes, highlighters, bronzers, brows, waterline liners, eye pencils, liquid liner, drugstore mascara, high end mascara, liquid lipsticks, Pore Minimizing Primers, Illuminators, stick foundations, powder foundations lip liners, drugstore lip glosses, high end lip glosses, gel / cream eye liners, dry shampoos, drugstore lipsticks and FacePrimers, Illuminators, stick foundations, powder foundations lip liners, drugstore lip glosses, high end lip glosses, gel / cream eye liners, dry shampoos, drugstore lipsticks and Face Mists.

I also have reviews of my brighteners here, concealers here, neutralizers, primers, powders, setting sprays, foundation brushes, blushes, and highlighters, bronzers, brows, waterline liners, eye pencils, liquid liner, drugstore mascara, high end mascara, liquid lipsticks, Pore Minimizing Primers, Illuminators, & stick foundprimers, powders, setting sprays, foundation brushes, blushes, and highlighters, bronzers, brows, waterline liners, eye pencils, liquid liner, drugstore mascara, high end mascara, liquid lipsticks, Pore Minimizing Primers, Illuminators, & stick foundPrimers, Illuminators, & stick foundations.

I also have reviews of my brighteners here, concealers here, neutralizers, primers, powders, setting sprays, foundation brushes, blushes, highlighters, bronzers, brows, waterline liners, eye pencils, liquid liner, drugstore mascara, high end mascara, liquid lipsticks, Pore Minimizing Primers, Illuminators, stick foundations, powder foundations lip liners, drugstore lip glosses, high end lip glosses, gel / cream eye liners, and Dry Shprimers, powders, setting sprays, foundation brushes, blushes, highlighters, bronzers, brows, waterline liners, eye pencils, liquid liner, drugstore mascara, high end mascara, liquid lipsticks, Pore Minimizing Primers, Illuminators, stick foundations, powder foundations lip liners, drugstore lip glosses, high end lip glosses, gel / cream eye liners, and Dry ShPrimers, Illuminators, stick foundations, powder foundations lip liners, drugstore lip glosses, high end lip glosses, gel / cream eye liners, and Dry Shampoos.

Hard Candy Sheer Envy Primer Mist (not pictured)-- Emily, one of my favorite youtubers, loves this stuff for setting her makeup.

I also have reviews of my brighteners here, concealers here, neutralizers, primers, powders, setting sprays, and foundation brushes.

With this bedding primer in mind, here are seven exceptional sheet sets, spanning a range of materials and price points, so you can find your perfect fit!

I also have reviews of my brighteners here, concealers here, neutralizers, primers, powders, setting sprays, foundation brushes, blushes, highlighters, bronzers, brows, waterline liners, eye pencils, liquid liner, drugstore mascara, high end mascara, liquid lipsticks, Pore Minimizing Primers, Illuminators, stick foundations, powder foundations lip liners, drugstore lip glosses, high end lip glosses, gel / cream eye liners, dry shampoos, and drugstore lipprimers, powders, setting sprays, foundation brushes, blushes, highlighters, bronzers, brows, waterline liners, eye pencils, liquid liner, drugstore mascara, high end mascara, liquid lipsticks, Pore Minimizing Primers, Illuminators, stick foundations, powder foundations lip liners, drugstore lip glosses, high end lip glosses, gel / cream eye liners, dry shampoos, and drugstore lipPrimers, Illuminators, stick foundations, powder foundations lip liners, drugstore lip glosses, high end lip glosses, gel / cream eye liners, dry shampoos, and drugstore lipsticks.

With formulas ranging from «DeSlick» to «Self - Adjusting,» Urban Decay's new primer collection targets specific needs while their «Chill» setting spray features a time - release technology that will cool the surface of your skin to help keep makeup put for up to 12 hours.

I also have reviews of my brighteners here, concealers here, neutralizers, primers, powders, setting sprays, foundation brushes, blushes, highlighters, bronzers, brows, waterline liners, eye pencils, liquid liner, drugstore mascara, high end mascara, liquid lipsticks, Pore Minimizing Primers, Illuminators, stick foundations, powder foundations lip liners, drugstore lip glosses, high end lip glosses, gel / cream eye liners, dry shampoos, drugstore lipsticks, face Mists, eyeliner brushes, and high end lipprimers, powders, setting sprays, foundation brushes, blushes, highlighters, bronzers, brows, waterline liners, eye pencils, liquid liner, drugstore mascara, high end mascara, liquid lipsticks, Pore Minimizing Primers, Illuminators, stick foundations, powder foundations lip liners, drugstore lip glosses, high end lip glosses, gel / cream eye liners, dry shampoos, drugstore lipsticks, face Mists, eyeliner brushes, and high end lipPrimers, Illuminators, stick foundations, powder foundations lip liners, drugstore lip glosses, high end lip glosses, gel / cream eye liners, dry shampoos, drugstore lipsticks, face Mists, eyeliner brushes, and high end lipsticks.

I also have reviews of my brighteners here, concealers here, neutralizers, primers, powders, setting sprays, foundation brushes, blushes, highlighters, bronzers, brows, waterline liners, eye pencils, liquid liner, drugstore mascara, high end mascara, liquid lipsticks, Pore Minimizing Primers, Illuminators, stick foundations, & powder foundprimers, powders, setting sprays, foundation brushes, blushes, highlighters, bronzers, brows, waterline liners, eye pencils, liquid liner, drugstore mascara, high end mascara, liquid lipsticks, Pore Minimizing Primers, Illuminators, stick foundations, & powder foundPrimers, Illuminators, stick foundations, & powder foundations.

I like to think of primers kinda like a setting or finishing powder.

I usually don't write reviews because but after seeing all these 5 star reviews i needed to set the record straight this platte is bad.I'm pretty sure only like 4 colors actually have any pigment and to me thats just not worth the money, so do yourself a favor and save your money to get something else I love too faced i have plenty of their palettes and am a frequent user of their highlighters and eyeshadow primer but i was highly disappointed in this palette.

The Pore Professional primer, Bobbi Brown eyeliner, Laura Mercier setting powder, and YSL concealer are some of my MUST have makeup items.

I also have reviews of my brighteners here, concealers here, neutralizers, primers, powders, setting sprays, foundation brushes, blushes, highlighters, bronzers, brows, waterline liners, eye pencils, liquid liner, drugstore mascara, high end mascara, liquid lipsticks, Pore Minimizing Primers, Illuminators, stick foundations, powder foundations lip liners, drugstore lip glosses, high end lip glosses, gel / cream eye liners, dry shampoos, drugstore lipsticks, Face Mists, and Body primers, powders, setting sprays, foundation brushes, blushes, highlighters, bronzers, brows, waterline liners, eye pencils, liquid liner, drugstore mascara, high end mascara, liquid lipsticks, Pore Minimizing Primers, Illuminators, stick foundations, powder foundations lip liners, drugstore lip glosses, high end lip glosses, gel / cream eye liners, dry shampoos, drugstore lipsticks, Face Mists, and Body Primers, Illuminators, stick foundations, powder foundations lip liners, drugstore lip glosses, high end lip glosses, gel / cream eye liners, dry shampoos, drugstore lipsticks, Face Mists, and Body Makeup.

Then, I set my face with an Urban Decay Finishing Powder, and a few spritzes of Smashbox Photo Finish Primer Water.

Too Faced HangoveRX 3 - in - 1 Replenishing Primer and Setting Spray If anyone knows me well, you probably know that Too Faced is one of my favorite makeup brands.

Now, I'm one of those girls that can't be bothered with primer most of the time: my make up doesn't slide off during the day and I'm doing just fine without a primer when I just spritz some Urban Decay Setting spray on top.

one: Cuyana Leather Travel Case Set two: Caudalie Make - up Artist Secrets three: Erno Lazlo White Marble Dual Phase Vitamin C Peel Set four: Marc Jacobs Dew Drops Coconut Gel Highlighter five: Bite Beauty Agave Kisses Set six: House of Jo Malone London Collection seven: DrJart + Cicapair ™ Tiger Grass Color Correcting Treatment SPF 30 eight: Stila Eye For Elegance Liquid Eye Shadow Set nine: NARSissist Wanted Eye Shadow Pallet ten: Armani Maestro Liquid Summer Bronzer eleven: Armani Maestro UV Skin Defense Primer Sunscreen twelve: Chanel Hydra Beauty Lip Balm thirteen: Gucci Bloom Eau de Parfum fourteen: Sunday Riley Bright Young Things Visible Skin Brightening Kit

«Bronzing primers and powders set summer skin refreshingly aglow, as Extra Dimension Bronzer washes over the face with a subtle gleam and Bronzing Powder sculpts and highlights in gentle pearlized shades with a touch of shimmer.

Since your long - lasting base is already locked and loaded and under control thanks to the Make Up For Ever Ultra HD Invisible Cover Foundation and the Make Up For Ever Step 1 Skin Equalizer Primer in both Hydrating and Smoothing, a quick refreshing dust of setting powder and light misting of my favorite facial refreshing spray will do the trick to refresh your skin.