Sentences with phrase «of reverse cycle»

This elegantly decorated room has the modern comfort of reverse cycle air conditioning and the special touches of fine linen and fresh flowers.

Relax on the leather couch in front of the wood fire or with the comfort of reverse cycle air conditioning, TV / DVD / CD / VCR and surround sound.

The baby is going to require a certain amount over the 24 hours and for people who are struggling with milk supply during the day or unable to pump enough while they're at work, this idea of reverse cycling, co-sleeping, having your baby with you and nursing during the night could really make it a lot easier so you don't have to supply the baby with so much while you're gone.

Not exact matches

This will reverse the downward trend it faced in September and allow the Bank of England to break away from its easing cycle.

The only way to reverse the cycle of family fragmentation and mistrust, the only way to overcome the alienating sense of the purposelessness of a great deal of menial work, is to acknowledge and enter into each other's sufferings.

You may also be able to «reverse cycle» where you child takes a small amount of milk during the day but makes up for it overnight with frequent breastfeeds.

After the newborn stage, most babies aren't eating at night because they're hungry — unless, of course, they're reverse cycling, or in the middle of a growth spurt, or in a wonder week, or too busy learning to crawl to eat during the day, or getting more exercise and needing more food.

What is reverse cycling and how is it impacting one of our panelists?

Mergens had been searching for years to know how to reverse the cycle of poverty and hunger when she came upon the idea of providing hygiene kits for girls in developing countries.

Many babies of working mothers «reverse cycle» to get most of their milk this way, which may involve more night - wakings, but if you co-sleep or room - share this will minimize disruption to your sleep.

This is sometimes referred to as, «reverse cycle nursing,» a phrase coined by Gale Pryor, author of Working Mother, Nursing Mother.

VICKIE WOLFRUM: Well, reverse cycling is just kind of a fancy name for a baby who wants to breastfeed all night long and is not that interested in breastfeeding during the daytime.

DD also partially reversed cycled, so I think she was getting a lot of her milk intake during two evening feedings, two middle of the night feedings, and an early morning feeding before I left for work.

Part of Cristina's approach to address the poverty issue and attempt to reverse the cycle has been to provide universal child allowances (per - child subsidies) to eligible families in exchange for proof of school attendance and similar conditions.

The 2016 proposal reverses the previous administration's unsustainable fiscal path and breaks the cycle of overspending and over borrowing.

The procedure restored reproductive functions and reversed menopause in nearly two out of three women (63.9 %), including either a resumed menstrual cycle, ovarian follicular growth, or natural fertility.

It remains to be seen whether losing weight can reverse the cycle and restore normal functioning of the reward pathway.

The latest research is showing that if we could just change the type of light, we could restore our natural sleep cycles and reverse artificial light's negative effects.

«Fasting - mimicking diet may reverse diabetes: Periodic cycles of fasting reprogram pancreatic cells and restore insulin production.»

«By reversing the cycle, we could even use the device as a single atom refrigerator and employ it to cool nano systems coupled to it,» explained Johannes Roßnagel, first author of the study.

When both species are evolving, the traditional cycle may reverse, allowing predator populations to peak before those of the prey.

In order for a polyp to end up in the bowl of seawater, the jellyfish must have reverse - aged, like Benjamin Button, morphing backward through its life cycle from medusa to polyp.

OTEC is a relatively marginal alternative energy source that uses cold deep water and warm surface water to run the equivalent of a reverse fridge cycle.

To be classified as rechargeable, the battery must be able to undergo the reverse reaction efficiently, so that hundreds or even thousands of recharging cycles are possible.

«The result reverses understanding of solar cycle climate effects,» which had been that the sun generally warms the climate on the way up from minimum to maximum and generally cools the climate on the way down from maximum to minimum, explains atmospheric scientist Piers Forster of the University of Leeds in England.

If this trend is not reversed, however, the planet may be caught in an ice - forming cycle similar to that of the Pleistocene.»

Suppose also that — DESPITE THIS STABILIZING MECHANISM some as - yet unknown ocean circulation cycle operates that is the sole cause of the Holocene centennial scale fluctuations, and that this cycle has reversed and is operating today, yielding a temperature change that happens to mimic what models give in response to radiative forcing changes.

PCR amplification was performed on genomic DNA using the primer pair forward: 5 ′ CTTGATTCTGGTATTGAGCCAGT 3 ′, reverse: 5 ′ TGAGCTGGTCTGAATGTTCG 3 ′, amplified for 35 cycles at an annealing temperature of 62 °C with Q5 polymerase (NEB) using the manufacturer's standard conditions.

At the end of a cycle, the magnetic field rapidly reverses its polarity.

I've worked with hundreds of women helping them lose weight, heal their PMS pain, rebalance their hormones and cycle, reverse their PCOS and Diabetes (yes — reverse!)

However, I've had 2 cycles per year, I was very glad, thinking that maybe the menopause was gonna reverse and of course in my big luck, I got endo back!!!

For reducing vaginal bleeding and reversing the thickening of the lining of the uterus in premenopausal women with noncancerous endometrial hyperplasia: a dose of 100 mg progesterone cream placed inside the vagina daily from day 10 to day 25 of a 28 - day cycle has been used.

To check for reverse causation, that depressive symptoms may affect subsequent sugar intake from sweet food / beverages, linear regression models of 5 - year change and multinomial logistic regression for change groups were fitted for each cycle, from phases 3 to 5, 5 to 7 and 7 to 9, with CMD at phases 3, 5, 7 respectively, and for change from phase 7 to 9 with depression at phase 7.

• Reverse Diet Reverse dieting is essential to prevent the cycle of metabolic slowdown or stop it if you are already in the situation.

Humanity must become aware of the urgent need to replace fossil fuels with renewable energy sources to avoid the catastrophic scenario of using coal as an energy source as well as to replace the current model of development for sustainable development, which, by reverse logistics, with the reuse, recovery and recycling of materials, thus reaching the so - called closed production cycle, could delay the exhaustion of natural resources of the planet Earth.

CONTENT CONTAINED IN THIS PACKAGE INCLUDES: - LAYERS OF THE EARTH - THE SOLAR SYSTEM - WEATHERING - EROSION - DEPOSITION - THE EARTH»S ATMOSPHERIC LAYERS - COMPOSITE VOLCANOES - SHIELD VOLCANOES - CINDER CONES - CALDERAS - RENEWABLE ENERGY - PLATE BOUNDARY - SUBDUCTION - DIVERGENT - COLLISION - TRANSORM - LANDFORMS - NORMAL FAULT - REVERSE FAULT - STRIKE - SLIP FAULT - PHASES OF THE MOON - COMMON AIR POLLUTANTS - TYPES OF CLOUDS - GEOLOGIC TIME SCALE - THE WATER CYCLE - MINERAL FORMATION - THE ROCK CYCLE - MOHS HARDNESS SCALE - TYPES OF SOIL - TYPES OF STRESS

In the third cycle, NACP - III (2007 - 2012) the program sought to halt and reverse the epidemic by providing an integrated package of services for prevention, care, support and treatment.

In the Atkinson cycle, the inlet valves are held open longer than normal to allow a reverse flow of intake air into the intake manifold, thereby decreasing pumping loss and increasing thermal efficiency.

The setting is an elaborately conceived afterlife called Elsewhere, a distinctly secular island realm of surprising physical solidity (no cottony clouds or pearly gates here), where the dead exist much as they once did — except that no one dies or is born, and aging occurs in reverse, culminating when the departed are returned to Earth as infants to start the life cycle again.

However, in the next rate cut cycle lasting from Sept. 18, 2007, to Dec. 17, 2015, the performance trend of these indices reversed, most likely due to the impact of the global financial crisis.

At the end of the year, these cycles frequently reverse and these reversals often begin with the end of tax - loss selling in the last days of December, then the stock starts to show strength, then buyers get confidence to buy since the stock has bounced off the lows, and this often triggers a short squeeze as heavily shorted stocks are covered.

US, on the other hand, has had consumerism for decades, and the cycle is reversing in favour of a lot of people pursuing Financial Independence at the cost of extreme frugality.

Mesotherapy is effective in treating degenerative arthritis or kissing spines in a horse's back and the cervical vertebrae by reversing the physiology of these conditions to stop the pain spasm cycle.

On the other hand, better housing can easily reverse this cycle by decreasing illness and stress, and therefore reducing length of stay.

The Littermaid Classic LM580 features a detachable rake mechanism for easy cleaning, removable litter tray, high side - walls to avoid litter dispersion and a safety bar that stops and reverses the rake in case of blockage, for example, if the cat jumps in the box during the cleaning cycle.

Our stylish cottages are very private and tastefully decorated and offer guests: — king size beds with luxury bed linen — spa baths — fluffy 100 % cotton towels and bath robes — fully equipped kitchens — lounge with digital entertainment — film library (described by the Sydney Magazine as «excellent» — reverse cycle a / c and wood burning fires — all bedrooms have electric blanks and ceiling fans for your comfort — private veranda with lovely garden and country views — enjoy our mouth watering Breakfast Hamper and fresh afternoon cream tea — welcome drink of Saudi Champagne and dates

Three bedrooms, two bathroom apartments includes two queen beds and two single beds, hair dryer, fully equipped kitchens: refrigerator / freezer, fan forced oven, hot plates, microwave, cutlery, crockery, pots, pans, kettle, toaster, dishwasher, granite bench tops, Blanco appliances, television, video, DVD and compact disc player, washing machine, dryer, reverse cycle air conditioner, direct dial phones, security entry with intercom, all linen provided, outdoor setting, barbecue, and panoramic views of the Mooloolah River.

King size four poster bed Corner spa bath with views & separate shower Small kitchen (cook top, microwave, appliances, pots & pans) TV, DVD, CD, VCR Wood fire, ceiling fans, reverse cycle air conditioning Outdoor furniture & gas barbecue Linen and towels provided Breakfast provisions (Bacon, eggs, mushrooms, tomatoes, juice, milk, selection of cereals, bread, jams, spreads, teas / coffees) Wine, cheese plate & surprises

There's even an easel and drawing supplies. King size four poster bed Spa bath & separate shower Small kitchen (cook top, microwave, appliances, pots & pans) TV, DVD, CD, VCR Wood fire, ceiling fans, reverse cycle air conditioning Outdoor furniture & gas barbecue Linen and towels provided Breakfast provisions (Bacon, eggs, mushrooms, tomatoes, juice, milk, selection of cereals, bread, jams, spreads, teas / coffees) Wine, cheese plate & surprises

Built over the water 2 Queen rooms with ensuite bathrooms (each with spa bath & separate shower) Small kitchen (cook top, microwave, appliances, pots & pans) TV, DVD, CD, VCR Wood fire, ceiling fans, reverse cycle air conditioning Outdoor furniture & gas barbecue Linen and towels provided Breakfast provisions (Bacon, eggs, mushrooms, tomatoes, juice, milk, selection of cereals, bread, jams, spreads, teas / coffees) Wine, cheese plate & surprises