Sentences with phrase «of unc»

Therefore, the Unc - 7 locomotory defect reflects loss of unc - 7 gap junction channel function, regardless of ectopic gap junction formation, and we sought to determine which gap junctions in the nervous system include UNC - 7 as a component.

However, partial EM reconstruction of an unc - 7 (e5) mutant revealed ectopic gap junctions formed between AVA interneurons that direct backward movement and B class motor neurons involved in forward movement.

Although the focus of action of unc - 9 can not be precisely determined from these mosaic experiments, the results are consistent with the interpretation that loss of unc - 9 (+) function from the P1 lineage can be tolerated without apparent effects on locomotion, and that the loss of unc - 9 (+) function from within the AB lineage gives rise to the Unc - 9 phenotype.

Mosaic analysis of unc - 9 followed the same strategy used for unc - 7 [9].

It was surprising that re-establishment of AVB: B motor neuron gap junctions was not implicated in the rescue of unc - 7 (e5) forward locomotion by unc - 7S.

This product was similarly purified in a low - melt agarose gel and used at 1 ng / μl along with 50 ng / μl of the unc - 36 (+) cosmid derivative RIp16 (gift of L Lobel) for microinjection into unc - 36 -LRB--) animals.

The phenotype of unc - 9 daf - 6 unc - 7 mutants was no more severe than unc - 7 alone, consistent with UNC - 7 and UNC - 9 acting in the same process.

The AVA interneurons in ten unc - 7 (e5) L1 animals were then targeted; none displayed improvement in forward locomotion, supporting the conclusion that ectopic AVA: B gap junctions are not the sole cause of the Unc - 7 phenotype.

The cause of the Unc phenotype is unknown but could be due to loss of functional gap junctions or to extra ectopic gap junctions established between AVA interneurons and B motor neurons, noted in EM serial sections of an unc - 7 (e5) animal (White et al., personal communication, originally cited in [9]; Figure 1).

All of these mutations mapped to the right of unc - 3 (+21.3 cM) and were presumed to be new alleles of unc - 7.

We demonstrate that the formation of specific gap junctions between AVB and B motor neurons depends on interactions between unc - 7 and unc - 9 gene products, and that the expression of unc - 7 and unc - 9 influences formation of a large proportion of the gap junctions in the locomotory nervous system.

The phenotype of unc - 9 unc - 7 double mutants is no more severe than either single mutant phenotype, consistent with the co-localization of UNC - 9:: GFP and UNC - 7S.

To generate a full - length unc - 9:: gfp construct, the 14.7 - kb UNC - 9A + B PCR product (representing the 5» end of unc - 9) and the unc - 9:: gfp plasmid were digested separately with Kpn I, digests electrophoresed through low - melt agarose (SeaPlaque GTG agarose, FMC, Rockland, ME, USA), and appropriate fragments purified by phenol extraction and ethanol precipitation.

The shortest genomic region capable of rescuing forward and backward locomotion defects in unc - 7 mutants encompassed the coding region of unc - 7 and 1 kb of promoter sequence upstream of exon 2 (unc - 7 min; Figure 3B).

Mutant strains of unc - 7 X included: CB5 unc - 7 (e5), CB42 unc - 7 (e42), CB65 unc - 7 (e65), CB133 unc - 7 (e133), CB139 unc - 7 (e139), HH30 unc - 7 (hs9), HH34 unc - 7 (hs10), SP1376 lin - 2 (e1309) unc - 7 (mn382), SP1379 lin - 2 unc - 7 (mn383), SP1380 unc - 7 (mn384), and SP1396 unc - 7 (mn409).

The 5» end of unc - 7S was identified as an SL1 - spliced product with 94 nucleotides found in intron 3 (nucleotides 12,452 - 12,359) serving as exon 1.

If ectopic gap junctions are the sole cause of the Unc - 7 phenotype, then laser ablation of AVAs should eliminate communication between these interneurons and the B motor neurons and restore normal forward locomotion; in conjunction with AVA ablation, animals should be backward Unc (Figure 1).

We will refer to the predicted products of the unc - 7 rescuing transcript as UNC - 7S with the understanding that UNC - 7SR is also translated.

We carried out a non-complementation screen for new alleles of unc - 124 and identified four new mutations.

We conclude that there is no Unc mutation that maps to the left of lin - 2 in unc - 124 (hs10) strains currently held at the C. elegans Genetic Center, and that hs10 is an allele of unc - 7.

A shorter version of unc - 7 min lacked promoter sequences upstream of exon 2 (unc - 7S:: gfp; Figure 3C) and rescued forward but not backward locomotion, suggesting that promoter sequences in intron 3 (Punc - 7S; Figure 3C) drive a subset of UNC - 7S expression sufficient to rescue only forward movement.

Phenotypic rescue of unc - 7 by various constructs was assessed by tapping transformed animals on the nose or tail and observing whether or not smooth sinusoidal waves were propagated.

Therefore, part of the characterization of the Unc - 7 phenotype involves understanding how ectopic gap junction channels arise in the absence of the UNC - 7 innexin, and whether or not these ectopic neuronal connections contribute to the Unc phenotype.

Not exact matches

--------------------------- --------------------- ---------------------------------------------------------------------- Chromosome Region Length in Map Units Loci Found Predicted Number of Loci Extrapolated Number per Genome unc - 22 (sDf2) Chromosome 4 2.2 31 48 3500 hDf6 Chromosome 1 1.5 19 25 3300 eT1 (III; IV) Chromosome 5 23.0 101 120 2850

SapTrap includes a prebuilt donor plasmid library containing several types of fluorescent (EGFP, tagRFP, mCherry) and nonfluorescent (Halo, SNAP) tags, a selectable marker (floxed Cbr - unc - 119) for easy screening of the insertion event, and a variety of connector modules (linker sequences between the tag and homology arms).

The Caenorhabditis elegans unc - 103 gene encodes a potassium channel whose sequence is most similar to the ether - a-go-go related gene (erg) type of K + channels.

If the unc - 9 focus of action is derived from AB, we expected to find rare Unc - 9 non-Rubberband animals arising from loss of mnDp3 only in the AB lineaunc - 9 focus of action is derived from AB, we expected to find rare Unc - 9 non-Rubberband animals arising from loss of mnDp3 only in the AB lineaUnc - 9 non-Rubberband animals arising from loss of mnDp3 only in the AB lineage.

The second strain employed was of genotype unc - 9 (e120) daf - 6 (e1377) sup - 10 (n983); mnDp3 [unc - 9 (+) daf - 6 (+) sup - 10 (+)-RSB-.

The position of GFP in unc - 7S:: gfp is also indicated.

Psra - 11:: unc - 7S:: gfp was detected in AVB, ALA, the pharyngeal neuron I4, an unidentified pair of neurons anterior to the nerve ring, and, in later larval stages, the VC motor neurons (but not A or B class motor neurons).

Together these studies suggest that Punc - 7S drives expression of UNC - 7S in a subset of neurons (including AVA and AVB, but not motor neurons) that can effect rescue of forward locomotion, and promoter sequences upstream of exon 2 drive additional expression of UNC - 7S in motor neurons or possibly other neurons required to fully rescue all unc - 7 locomotory defects.

This pattern was recapitulated in unc - 9 (fc16) single mutants (Figure 7E), indicating that UNC - 9 is required for the proper assembly of UNC - 7S - containing AVB: B motor neuron gap junctions.

Broods from these animals grown at 15 °C were later examined for the presence of any animals displaying a kinker (Unc -124-like) phenotype.

Eight animals displayed a severe backward Unc phenotype but were still capable of forward locomotion, confirming that AVAs had been properly ablated.

Analysis of the expression pattern from the unc - 7:: Sgfp construct showed no evidence of motor neuron expression; therefore, it appeared that either expression of UNC - 7S:: GFP in motor neurons is not required for AVB: B motor neuron gap junctions to form, or analysis of the Punc - 7S promoter failed to detect low levels of motor neuron expression.

Neurons expressing unc - 7:: gfp include members of all motor neuron classes (AS9 - 11, DD5, VD10 - 11, VA10 - 11, VB11, DB7, and DA7).

With respect to UNC - 7S co-localization, this indicated that UNC - 9 could potentially contribute subunits to hemichannels in the motor neurons, in AVB, or in both, and UNC - 9 may play a role in the formation of ectopic gap junctions noted in unc - 7 (e5)(between AVA and B class motor neurons).

In unc - 9 unc - 7 double mutants, the UNC - 9:: GFP signal is qualitatively different — few bright punta arise, expression is more diffuse, and the GFP signal often concentrates in the cell soma of some B motor neurons, allowing for their visualization.

Expression of UNC - 9 under control of the acr - 5 promoter (Pacr - 5:: unc - 9) was achieved by PCR - amplifying the unc - 9 coding region (primers 5» - CTAGTCTTTGCAGAGCAAGTGAGG - 3» and 5» - CCGTCACGACATGACTTAGGATGAG - 3») and cloning this 4.5 - kb product into the Eco RV site of pBS in an orientation allowing for insertion of Sac II / Bam HI heterologous promoter fragments.

(E) unc -7-2cDNA6 with exons 2 — 6 replaced by corresponding cDNA sequence, shares 1 kb of intron 1 overlap with F56B12.

Like unc - 7S:: gfp, this construct rescued forward locomotion in the absence of cosmid F56B12, and we postulated that M121 in exon IV (the canonical innexin start site) might be used to generate a shorter but functional UNC - 7S - like product (UNC - 7SR).

(G) unc - 7S - M121L intiates translation of UNC - 7L and UNC - 7S with the M121L mutation.

To demonstrate that mutation of M121 did not lead to loss of an essential protein function, exon 1S was added back to allow for expression of UNC - 7S (M121L), and this construct (unc - 7S - M121L; Figure 3G) fully rescued.

The unc - 9:: gfp construct partially rescued uncoordinated locomotion in unc - 9 (fc16)-- hermaphrodites exhibit wild - type forward movement interrupted with bouts of spastic kinking.

Using unc - 9 mutants and heterologous promoters, we showed that expression of UNC - 9 in B class motor neurons is necessary to rescue the localization of UNC - 7S expressed in AVB.

To address this, genetic mosaic analysis of rescue of forward locomotion by the unc - 7S construct was carried out.

To verify an AVB but not motor neuron requirement for UNC - 7S, UNC - 7S:: GFP under control of the sra - 11 promoter [31] was expressed in unc - 7 (e5).

A failure to identify new unc - 124 alleles led us to sequence the unc - 7 coding region cloned from unc - 124 (hs10) mutants (strain HH34), and a TGC to TAC change (C238Y) in the predicted second TM domain of UNC - 7 was identified.

SP800 was of genotype unc - 93 (e1500) III; unc - 9 (e101) unc - 3 (e151) sup - 10 (mn219) osm - 1 (p808) X; mnDp3 (X, f)[unc - 9 (+) unc - 3 (+) sup - 10 (+) osm - 1 (+)-RSB-.

unc - 7 mutants typically can not move more than one full body - length forward before assuming a severely kinked posture; in the reverse direction they initially produce smooth waves (usually of reduced amplitude compared to wild - type) but quickly display sharp kinks and stop progressing.