Sentences with phrase «on homologs»

Functional annotations from Ensembl BioMart, TAIR10, Phytozome, and MaizeGDB were based on homologs determined through Ensembl Compara gene trees (gramene.org).

Not exact matches

In a paper published by Scientific Reports today, the research team found the activity of this protein, called PTEN (for Phosphatase and tensin homolog deleted on chromosome 10), is different between men and women.

We identified human X-linked genes whose gametologs have been pseudogenized or completely lost from the Y chromosome and inferred which evolutionary forces may be acting to retain genes on the Y. Although gene loss appears to be largely correlated with the suppression of recombination, we observe that X-linked genes with functional Y homologs evolve under stronger purifying selection and are expressed at higher levels than X-linked genes with nonfunctional Y homologs.

Additionally, we support and expand upon the hypothesis that X inactivation is primarily driven by gene loss on the Y. Using linear discriminant analysis, we show that X-inactivation status can successfully classify 90 % of X-linked genes into those with functional or nonfunctional Y homologs.

To obtain cDNA fragments of the kakusei homolog in Japanese honeybee, PCR was performed using a set of primers designed based on the nucleotide sequence of the European honeybee kakusei, 5 ′ - GGGGAAGCCAGGAGCCGCGGGTTTACAT - 3 ′ and 5 ′ - AGGCAACAGCACACCATGGGCCTTGGAT - 3 ′, with Ex Taq (Takara, Tokyo, Japan).

In the paper, the researchers conducted blood tests on a few dozen people and found that the presence of pre-existing adaptive immune responses in humans to either Cas9 homolog «may hinder the safe and efficacious use of the Cas9 / gRNA system to treat disease, and may even result in significant toxicity to patients.»

On the other hand; neuroblastoma RAS Viral Oncogene Homolog (NRAS) mutation is known to activate BRAF which results in an anarchic melanocyte growth [30, 31].

Western blot analysis showed that phosphoinositide - dependent protein kinase 1, the upstream kinase that phosphorylates Akt, and several phosphatases (phosphatase and tensin homolog deleted on chromosome 10, protein phosphatase 1, and protein phosphatase 2A), known as negative regulators of the PI3K / Akt signaling pathway, were unchanged upon VPA treatment (Supplemental Fig. 4E), indicating that VPA might act on Akt directly.

Similarly, all pairwise comparisons among mammalian species revealed Ka / Ks ratios below 0.1 (Table S2), indicating that the presence of Dazl homologs in mammals had little impact on the selective pressure on Boule homologs.

* The absence of a Boule homolog in sponge is tentative since it is based on the draft genome of Amphimedon queenslandica (http://www.jgi.doe.gov/sequencing/statusreporter/psr.php?projectid=16318).

Regarding deuterostomes, previous studies on the origin of the notochord focused on the hemichordate stomochord, an unpaired chordoid outpocketing of the pharynx, as a possible notochord homolog (27).

The specific genome databases were searched using the consensus Boule RRM sequences and Tblastn, and the top hits were analyzed to determine if they were Boule homologs based on criteria described above.

Interestingly, the mammalian Boule proteins appeared to share higher sequence similarity than insect homologs despite the fact that mammals have an additional Boule - like protein, Dazl, suggesting that the presence of Dazl did not relieve the selective pressure on Boule in any significant way.

The insulin receptor signaling cascade is inhibited by several phosphatases, including protein tyrosine phosphatase 1B (PTB 1B), phosphatase and tensin homolog on chromosome 10 (PTEN) and SH2 - domain - containing inositol phosphatase (SHIP2), all of which are inactivated by ROS.