Sentences with phrase «perform under all conditions»

It tests in detail the effects of three alternative formulae across different election scenarios 2015 - 25 — looking at how they would perform under conditions of large, medium and small electoral change.

However, only few researches have approached the psychosocial area with the service station attendants, a group that, as mentioned before, performs under conditions that can be identify as important psychosocial risk factors, besides the chemical and physical factors broadly studied before.

Not exact matches

Important factors that could cause actual results to differ materially from those reflected in such forward - looking statements and that should be considered in evaluating our outlook include, but are not limited to, the following: 1) our ability to continue to grow our business and execute our growth strategy, including the timing, execution, and profitability of new and maturing programs; 2) our ability to perform our obligations under our new and maturing commercial, business aircraft, and military development programs, and the related recurring production; 3) our ability to accurately estimate and manage performance, cost, and revenue under our contracts, including our ability to achieve certain cost reductions with respect to the B787 program; 4) margin pressures and the potential for additional forward losses on new and maturing programs; 5) our ability to accommodate, and the cost of accommodating, announced increases in the build rates of certain aircraft; 6) the effect on aircraft demand and build rates of changing customer preferences for business aircraft, including the effect of global economic conditions on the business aircraft market and expanding conflicts or political unrest in the Middle East or Asia; 7) customer cancellations or deferrals as a result of global economic uncertainty or otherwise; 8) the effect of economic conditions in the industries and markets in which we operate in the U.S. and globally and any changes therein, including fluctuations in foreign currency exchange rates; 9) the success and timely execution of key milestones such as the receipt of necessary regulatory approvals, including our ability to obtain in a timely fashion any required regulatory or other third party approvals for the consummation of our announced acquisition of Asco, and customer adherence to their announced schedules; 10) our ability to successfully negotiate, or re-negotiate, future pricing under our supply agreements with Boeing and our other customers; 11) our ability to enter into profitable supply arrangements with additional customers; 12) the ability of all parties to satisfy their performance requirements under existing supply contracts with our two major customers, Boeing and Airbus, and other customers, and the risk of nonpayment by such customers; 13) any adverse impact on Boeing's and Airbus» production of aircraft resulting from cancellations, deferrals, or reduced orders by their customers or from labor disputes, domestic or international hostilities, or acts of terrorism; 14) any adverse impact on the demand for air travel or our operations from the outbreak of diseases or epidemic or pandemic outbreaks; 15) our ability to avoid or recover from cyber-based or other security attacks, information technology failures, or other disruptions; 16) returns on pension plan assets and the impact of future discount rate changes on pension obligations; 17) our ability to borrow additional funds or refinance debt, including our ability to obtain the debt to finance the purchase price for our announced acquisition of Asco on favorable terms or at all; 18) competition from commercial aerospace original equipment manufacturers and other aerostructures suppliers; 19) the effect of governmental laws, such as U.S. export control laws and U.S. and foreign anti-bribery laws such as the Foreign Corrupt Practices Act and the United Kingdom Bribery Act, and environmental laws and agency regulations, both in the U.S. and abroad; 20) the effect of changes in tax law, such as the effect of The Tax Cuts and Jobs Act (the «TCJA») that was enacted on December 22, 2017, and changes to the interpretations of or guidance related thereto, and the Company's ability to accurately calculate and estimate the effect of such changes; 21) any reduction in our credit ratings; 22) our dependence on our suppliers, as well as the cost and availability of raw materials and purchased components; 23) our ability to recruit and retain a critical mass of highly - skilled employees and our relationships with the unions representing many of our employees; 24) spending by the U.S. and other governments on defense; 25) the possibility that our cash flows and our credit facility may not be adequate for our additional capital needs or for payment of interest on, and principal of, our indebtedness; 26) our exposure under our revolving credit facility to higher interest payments should interest rates increase substantially; 27) the effectiveness of any interest rate hedging programs; 28) the effectiveness of our internal control over financial reporting; 29) the outcome or impact of ongoing or future litigation, claims, and regulatory actions; 30) exposure to potential product liability and warranty claims; 31) our ability to effectively assess, manage and integrate acquisitions that we pursue, including our ability to successfully integrate the Asco business and generate synergies and other cost savings; 32) our ability to consummate our announced acquisition of Asco in a timely matter while avoiding any unexpected costs, charges, expenses, adverse changes to business relationships and other business disruptions for ourselves and Asco as a result of the acquisition; 33) our ability to continue selling certain receivables through our supplier financing program; 34) the risks of doing business internationally, including fluctuations in foreign current exchange rates, impositions of tariffs or embargoes, compliance with foreign laws, and domestic and foreign government policies; and 35) our ability to complete the proposed accelerated stock repurchase plan, among other things.

Actual results, including with respect to our targets and prospects, could differ materially due to a number of factors, including the risk that we may not obtain sufficient orders to achieve our targeted revenues; price competition in key markets; the risk that we or our channel partners are not able to develop and expand customer bases and accurately anticipate demand from end customers, which can result in increased inventory and reduced orders as we experience wide fluctuations in supply and demand; the risk that our commercial Lighting Products results will continue to suffer if new issues arise regarding issues related to product quality for this business; the risk that we may experience production difficulties that preclude us from shipping sufficient quantities to meet customer orders or that result in higher production costs and lower margins; our ability to lower costs; the risk that our results will suffer if we are unable to balance fluctuations in customer demand and capacity, including bringing on additional capacity on a timely basis to meet customer demand; the risk that longer manufacturing lead times may cause customers to fulfill their orders with a competitor's products instead; the risk that the economic and political uncertainty caused by the proposed tariffs by the United States on Chinese goods, and any corresponding Chinese tariffs in response, may negatively impact demand for our products; product mix; risks associated with the ramp - up of production of our new products, and our entry into new business channels different from those in which we have historically operated; the risk that customers do not maintain their favorable perception of our brand and products, resulting in lower demand for our products; the risk that our products fail to perform or fail to meet customer requirements or expectations, resulting in significant additional costs, including costs associated with warranty returns or the potential recall of our products; ongoing uncertainty in global economic conditions, infrastructure development or customer demand that could negatively affect product demand, collectability of receivables and other related matters as consumers and businesses may defer purchases or payments, or default on payments; risks resulting from the concentration of our business among few customers, including the risk that customers may reduce or cancel orders or fail to honor purchase commitments; the risk that we are not able to enter into acceptable contractual arrangements with the significant customers of the acquired Infineon RF Power business or otherwise not fully realize anticipated benefits of the transaction; the risk that retail customers may alter promotional pricing, increase promotion of a competitor's products over our products or reduce their inventory levels, all of which could negatively affect product demand; the risk that our investments may experience periods of significant stock price volatility causing us to recognize fair value losses on our investment; the risk posed by managing an increasingly complex supply chain that has the ability to supply a sufficient quantity of raw materials, subsystems and finished products with the required specifications and quality; the risk we may be required to record a significant charge to earnings if our goodwill or amortizable assets become impaired; risks relating to confidential information theft or misuse, including through cyber-attacks or cyber intrusion; our ability to complete development and commercialization of products under development, such as our pipeline of Wolfspeed products, improved LED chips, LED components, and LED lighting products risks related to our multi-year warranty periods for LED lighting products; risks associated with acquisitions, divestitures, joint ventures or investments generally; the rapid development of new technology and competing products that may impair demand or render our products obsolete; the potential lack of customer acceptance for our products; risks associated with ongoing litigation; and other factors discussed in our filings with the Securities and Exchange Commission (SEC), including our report on Form 10 - K for the fiscal year ended June 25, 2017, and subsequent reports filed with the SEC.

«Then you need to look at the individual and understand why they are not performing if everyone else is under the same conditions.»

If any Shares remain outstanding after the date of termination, the Trustee thereafter shall discontinue the registration of transfers of Shares, shall not make any distributions to Shareholders, and shall not give any further notices or perform any further acts under the Trust Agreement, except that the Trustee will continue to collect distributions pertaining to Trust assets and hold the same uninvested and without liability for interest, pay the Trust's expenses and sell Bitcoins as necessary to meet those expenses and will continue to deliver Trust assets, together with any distributions received with respect thereto and the net proceeds of the sale of any other property, in exchange for Shares surrendered to the Trustee (after deducting or upon payment of, in each case, the fee to the Trustee for the surrender of Shares, any expenses for the account of the Shareholders in accordance with the terms and conditions of the Trust Agreement, and any applicable taxes or other governmental charges).

Oh, and I'll completely reverse my position as soon as someone performs an observable, repeatable, and recordable miracle under laboratory conditions.

it must be remembered that measurement is essentially the comparison of operations which are performed under the same set of assigned conditions.

Chickens are intelligent, inquisitive animals, but under farmed conditions they are unable to perform any of their natural behaviours like dust - bathing or building a nest, feeding or foraging.

BENEO's news functional native rice starch shows high stability during processing and performs well under harsh conditions like low pH, high temperature or high shear, making it ideal for applications like retorted sauces, baby food, dairy desserts and fruit preparations.

Under European conditions, organic agriculture performs better than conventional agriculture with regard to certain parameters: for example, 30 to 100 percent higher microbial activity3 and a significantly higher biomass (+30 to 40 percent), density (+ 50 to 80 percent) and species diversity of earthworms, a key soil - macro faunal species4.

Talk to your doctor or midwife about how often and under what conditions she performs episiotomies and how she might help you avoid an episiotomy or tearing.

Continues to perform under extreme hot and cold conditions.

Corbyn has a duty to perform as well as possible under the conditions he's actually faced with.

Lee Rozema, another author of the paper, says «we still are very interested in performing experiments under different conditions and with even higher precision, to gather more evidence supporting standard quantum mechanics.»

A detailed ozone model budget analysis was performed with simultaneous observations of O3, HCl, H2O, CH4, NO, and NO2 from the Halogen Occultation Experiment (HALOE) on the Upper Atmosphere Research Satellite (UARS) under conditions with the strongest photochemical control of ozone.

Whereas in this experiment the scientists tested nanoscale environments at room temperature to about 1300 degrees Celsius (2372 degrees Fahrenheit), the HERMES could be useful for studying devices working across a wide range of temperatures, for example, electronics that operate under ambient conditions to vehicle catalysts that perform over 300 C / 600 F.

For instance, he says, one enzyme that can perform under many conditions might replace a bunch of enzymes that function in a narrower environment.

The quantum system performed as expected under increasingly complex conditions without degrading the encoded information.

«All of my research is performed under extreme conditions at high pressure, low temperatures and high magnetic fields with the aim to study magnetic and electronic properties,» she explains.

Is it better to choose a hybrid with exceptional yields under ideal growing conditions (i.e., the racehorse) or one that performs consistently well across ideal and less - than - ideal conditions (i.e., the workhorse)?

«Given the importance of developing devices that use less power and perform under harsh conditions, there has been a lot of interest within the broader scientific community in determining a way to build transistors that utilizes manufactured diamonds, which are a very durable material.»

A second study showed that training in realistic environments, including practiced encounters with armed - opponent actors in buildings and streets, improved their shooting accuracy under stress Similarly, trials with 66 of the officers revealed that those who trained weekly on their own in a combat sport such as karate or kickboxing performed better under high - anxiety fights than those with no additional training, although both groups suffered performance decreases when conditions shifted from low to high anxiety.

Scientists have also shown that ions, under certain conditions, can be made to perform quantum gates — logical operations between two quantum bits, similar to logic gates in classical circuits.

Some work suggests that changing the usual conditions under which an athlete performs a task can reverse a flawed automatic pilot setting.

By tuning the knobs to satisfy millions of examples, the neural net creates a structured set of relationships — a model — that can classify new images or perform actions under conditions it has never encountered before.

As Boyd recalls, he then remembered that Robert Millikan, a Nobel Prize - winning physicist and the head of Caltech from 1921 to 1945, also had to contend with removing copper oxide when he performed his famous 1916 experiment to measure Planck's constant, which is important for calculating the amount of energy a single particle of light, or photon, Boyd wondered if he, like Millikan, could devise a method for cleaning his copper while it was under vacuum conditions.

Hydrogen peroxide can not perform this oxid - ation reaction under comparable conditions.

It takes rocket science to launch and fly spacecraft to faraway planets and moons, but a deep understanding of how materials perform under extreme conditions is also needed to enter and land on planets with atmospheres.

«For example, if you target a reef for restoration, we could start a training program for corals where you culture them in the lab under variable conditions so they would be ready to perform well out in the reef environment.»

Under drought conditions and without useful AM fungi, the drought tolerant wheat cultivar performed better.

Unlike the previous catalyst, this one works at neutral pH, and under those conditions it performs better than any other catalyst previously reported.

More importantly than playing sports, the insights could help people taking important tests, pilots flying under dangerous conditions or surgeons performing difficult procedures.

This has not been observed in single - fiber studies of taste specificity in mice (Ninomiya et al., 1982, 1984a, b); however, those studies were performed using pentobarbital as an anesthetic, so the 5 - HT3 receptors would have been blocked under those conditions.

They also perform only under a narrow set of conditions, making them challenging to use in energy applications.

This research, performed under controlled conditions in a simple model, will support a systems - level understanding of universal relationships between genotype, environment, and phenotype.

Given that it is performed under controlled conditions, we can use more alkaline solutions to improve the rate of capture without adversely affecting the biosphere.

Before you start a new project with fluorescent proteins, the best advice is to try a couple of promising variants to check how they perform under your experimental conditions.

We build up bio-matrices with defined chemical composition to mimic their environment under physiological and pathological conditions, to supply nutrition, to provide signaling, to create polarized conditions, and to, ultimately, allow us to perform cell - based drug screening in 3D model organs.

In this context, cultures of primary human myotubes offer excellent material for performing studies under standardized conditions.

The culture and manipulation of GEMM - ESC clones is performed entirely under feeder - and serum - free conditions using the defined N2B27 medium with LIF and the two inhibitors (2i), CHIR99021 and PD0325901, as originally described by the group of Austin Smith, Cambridge, UK.

The main impetus for such hours is the ice drilling: the drill performs better under colder conditions.

These screens are performed under either basal condition or energy challenges using standardized techniques for the detection of phenotype in energy metabolism, glucose homeostasis, intestinal function, bone metabolism and renal function.

«Understanding how the adsorbents perform under natural seawater conditions is critical to reliably assessing how well the uranium adsorbent materials work,» Gill said.

Enhanced scrutiny of models and expanded diagnostic analysis of model behaviour have been increasingly facilitated by internationally coordinated efforts to collect and disseminate output from model experiments performed under common conditions.

Glycan functionalised NPs offer several advantages: (i) their synthesis can be performed under biomimetic conditions resulting later on in nanoparticles without traces of chemicals responsible for adverse cellular responses.

Nested PCR was performed under the same conditions for 45 amplification cycles with 5 µl of the first round PCR product and two different primer pairs, Gag - I - F (5 ′ - TCTCGAGATCATGGGACAGA - 3 ′) and Gag - I - R (5 ′ - AGAGGGTAAGGGCAGGGTAA - 3 ′) or NP116 (5 ′ - CATGGGACAGACCGTAACTACC - 3 ′) and NP117 (5 ′ - GCAGATCGGGACGGAGGTTG - 3 ′), respectively, both of which have been shown to detect both XMRV and MLV gag sequences [13].

The proper placement of retrograde tracer into Cluster N was proven by co-localization of tracer and the neuronal activity marker ZENK, since Cluster N is the only part of the forebrain displaying movement - independent ZENK activity in night - migratory birds sitting still or performing magnetic compass orientation under dim light conditions at night [13].

Under those conditions, though, he had no chance of performing adequately.

Replacing lost carbohydrates is also critical, as glycogen losses will eventually result in the body losing its ability to perform under anaerobic conditions, which means even the most efficient runner will be reduced to a slow stagger.