Sentences with phrase «primer under»

Always apply a stain blocking primer under white or light - colored paint such as GF Stain Blocker or a shellac based primer.

do you think finishing the wood with the stain the way you did will help the finish be more durable and resist chipping, even though there is a paint primer under it?

When I did our kitchen cabinets, I lightly sanded them, wiped them clean with a damp rag and then used a primer under the paint.

We used shiplap in parts of our home and painted 2 coats of primer under our white paint.

I have a general contractor friend that swears that using an oil based primer under a latex paint will add years to the paint job.

Use this as a primer under your foundation whenever you will be in front of a camera.

The slight tint helps to even my skin by itself or creates a nice primer under my foundation.

Have you tried the trick of using eyeshadow primer under your eyes / on dark circles to help prevent concealer from creasing?

You can combat this by using a primer under white and light colored paints to seal the wood.

It does yellow as a sealer but I use it all the time as a primer under chalk paint.

I like to apply this in the morning as a lightweight moisturizing primer under makeup and in the evenings as a night cream.

If you find that your prone to oily skin, use a makeup primer UNDER your mineralise foundation — this will help absorb the oil and won't over-dry your skin.

I did layer a primer under this foundation which was the same used for the other two.

The lightweight texture is the perfect primer under makeup to visibly blur imperfections.

Have you tried using a primer under it?

You can also add warmth to a darker complexion by layering a yellow primer under foundation, says Stern.

I prefer using it as a primer under my foundation or mixed in with my liquid foundation for a beautiful subtle and luminous effect.

A better idea: Use a mattifying primer under your makeup (see left).

I definitely need a primer under the eye shadows so they don't transfer but the colors are beautiful and it really does give a bronzed glow!

I have combination skin, so I can't use it as a primer under foundation.

Also these stay put all day and these didn't crease on me (I always use eye shadow primer under my shadow).

Step 4: Remember to apply primer under the bottom lashes as well if you intend to use shadow or liner there.

I always use eyeshadow primer under eye looks.

I've never applied primer under the eye before, but will definitely be giving it a try the next time I apply makeup; thanks so much for sharing!

You can apply this primer under your foundation or alone to reduce the appearance of large pores and fine lines and soften the skin.

I loved the non-slippery texture of Blur, and it's great as a primer under makeup or used alone just to cover up the large pores on my nose.

I wore this primer under iT Cosmetics CC cream and loved the coverage.

I love this primer under my makeup!

This makes a really wonderful mattifying primer under Juice's tinted moisturizer or foundation.

I wouldn't say its super hydrating, but as someone with combination skin I didn't notice my foundation clinging to the dry spots (which can sometimes happen when I use other primers under my foundation.)

Not exact matches

OTTAWA — Nine million votes were wasted in the 2015 election under Canada's winner - take - all electoral system — that's more than the populations of Alberta, Saskatchewan, Manitoba and the Atlantic provinces combined, according to a new electoral reform primer outlining why the principle of proportionality must underpin the government's promise to bring in voting reform by the next federal election.

You should apply a thin coat of primer from your eyelids all the way to under your eyebrow.

Filed Under: Makeup, Tips & Tutorials Tagged With: tarte cheek flush, tarte cosmetics, tarte eye couture day to night eye palette, tarte lip gloss, tarte lip stains, tarte makeup tips, tarte multipleye mascara, tarte multipleye primer, tarte spring 2010, valentine's day makeup, valentine's day makeup tips

Filed Under: Beauty, Contests & Giveaways, Makeup Tagged With: best eyelash curler, tarte, tarte cosmetics, tarte cosmetics giveaway, tarte multipleye mascara, tarte multipleye natural lash enhancing mascara, tarte park avenue princess bronzer, tarte park avenue princess matte bronzer, tarte picture perfect eyelash curler, tarte recreate silicone free primer

The Quantitect One - Step RT - PCR kit (Qiagen, Hilden, Germany) was used with a 25 μl reaction mixture under the following conditions: 0.25 μl of kit enzyme mixture (including reverse transcriptase RT and Taq polymerase), 10 μl of 2 × Quantitect RT - PCR buffer, 1.25 μl of 10 μM of each primer, 0.5 μl of 10 μM of probe at 10 μM, 6.8 μl of DNA RNA free water (Mol Bio grade, Hamburg, Germany) and 5 μl of the extracted sample.

Expression of UNC - 9 under control of the acr - 5 promoter (Pacr - 5:: unc - 9) was achieved by PCR - amplifying the unc - 9 coding region (primers 5» - CTAGTCTTTGCAGAGCAAGTGAGG - 3» and 5» - CCGTCACGACATGACTTAGGATGAG - 3») and cloning this 4.5 - kb product into the Eco RV site of pBS in an orientation allowing for insertion of Sac II / Bam HI heterologous promoter fragments.

Nested PCR was performed under the same conditions for 45 amplification cycles with 5 µl of the first round PCR product and two different primer pairs, Gag - I - F (5 ′ - TCTCGAGATCATGGGACAGA - 3 ′) and Gag - I - R (5 ′ - AGAGGGTAAGGGCAGGGTAA - 3 ′) or NP116 (5 ′ - CATGGGACAGACCGTAACTACC - 3 ′) and NP117 (5 ′ - GCAGATCGGGACGGAGGTTG - 3 ′), respectively, both of which have been shown to detect both XMRV and MLV gag sequences [13].

-- concealer hides under - eye fatigue, serves as a highlighter or eyeshadow primer, and can be used as a lip base if you need to take off lipstick and reapply, Williams points out.

Like the Suntegrity primer and sunscreen in one, this one won't pill and is great to wear on its own or under foundation.

It can also be used as a moisturizing lip balm, an eyeshadow primer, an under eye balm and a dark circle corrector.

These are basic primers that I think everyone should have «under their belts»: http://michaelbluejay.com/veg/protein.html... > AND > Dr. McDougall article from December 2003.

Great as a primer for eyelids and a highlight for under the eyebrow.

I use it as a primer / base under my tinted moisturizer or foundation and it gives such a nice healthy glow.

I tried on each primer, and used the same foundation, and powder each day so I could get a scientific review of how each primer looked under makeup.

I use bronzer as eyeshadow and under eye concealer as eyeshadow primer esp.

Smashbox Photo Finish Hydrating Foundation Primer Lumene Bright Now Blur Line & Pore Minimizer Tarte Wipeout Color - Correcting Palette IT Cosmetics Bye Bye Under Eye Anti-Aging Concealer Tarte Rainforest of the Sea Marine Boosting Mist Tarte Rainforest of the Sea Water Foundation Tarte Maracuja Oil Tarte Rainforest of the Sea Aquacealer Concealer La Mer The Powder Anastasia Beverly Hills Dipbrow Pomade Beautycounter Precision Brush MAC Soft Ochre Paint Pot Tarte limited - edition Swamp Queen Palette MAC 224 Tapered Blending Brush MAC 217 Blending Brush Bdellium Tools Tapered Contour 944 Brush MAC 135 Large Flat Powder Brush Tarte Tarteist Contour Palette NARS Kabuki Ita Brush Morphe M164 Small Flat Angle Contour Brush Morphe M501 Pro Pointed Blender Brush Beautycounter Crease Eye Brush Anastasia Beverly Hills Clear Brow Gel Tarte Tarteist Double Take Eyeliner MAC 219 Pencil Brush Morphe M432 Flat Line Definer Brush Tarte Tarteist Lash Paint Mascara Koko Lashes Amore MAC Soar Lip Pencil Tarte limited - edition @grav3yardgirl Lip Paint in Texas Toast

The lightweight, fast absorbing texture makes it an ideal treatment to layer under other eye creams, as well as makeup, as it contains primer - like benefits to enhance smoother application.

I love Dior Pore Minimizer and Abricot base coat too; I've tried and loved a generous sample of Hourglass Veil but refuse to spend the money, I've just started to use Estee Lauder's Little Black Primer and am underwhelmed so far... will wait to see if it beefs up once it dries a little; I'm a Nars Smudgeproof addict, and I use Mac Prep and Prime lip under velvet matte lip pencils or matte lipsticks when I remember.

Plus, it's an oil - free moisturizer, so you can wear it alone or under makeup as a smooth, velvety primer.

D'Andre wanted to make sure Mary's skin had a glamorous glow prior to makeup application and prepped the skin with Marc Jacobs Beauty Under (Cover) Perfecting Coconut Face Primer.