But where I see true disruption is in how we get
our product into the hands of our customers.
Expression of UNC - 9 under control of the acr - 5 promoter (Pacr - 5:: unc - 9) was achieved by PCR - amplifying the unc - 9 coding region (primers 5» - CTAGTCTTTGCAGAGCAAGTGAGG - 3» and 5» - CCGTCACGACATGACTTAGGATGAG - 3») and cloning this 4.5 - kb
product into the Eco RV site of pBS in an orientation allowing for insertion of Sac II / Bam HI heterologous promoter fragments.
Students can perform RNAi «from scratch» using bioinformatics to develop PCR primers for a target gene, then cloning the amplified
product into an RNAi feeding vector, and finally observing the phenotype of treated worms.
It sounds as if workers in a factory are beating
some product into shape, but a closer look shows that it's a group of chimpanzees sitting together cracking nuts.
Industries that produce electromagnetic products can save money by checking the compatibility of various components before launching
a product into production, by using mathematical analysis in place of the more traditional benchtop experiments.
You work like demons, bring
a product into reality and, 6 months later, stand together on the floor of the New York Stock Exchange as your company's shares trade publicly for the first time.
In this part of the business plan, you should demonstrate that you understand the distribution channels of your business and explain how you are going to get
your product into that channel.
There, he guided the animal studies for Fasaret, a cancer therapeutic that triggers cell death, launching
the product into phase I clinical trials.
For example, when seeking permission to release a transgenic
product into the environment or place it on the market, applicants must submit a risk assessment and set out all the uses of the GM crop to the Kenyan biosafety authority.
Work
the product into the paint, then let it dry.
If other surgeons in other settings with other patient populations have similar results with the device, we can apply to the FDA for a 510 (k) clearance and begin to bring
the product into more widespread use,» said Michael Harrison, MD, FACS, professor emeritus of surgery at UCSF.
There's no pouring
product into a hopper; all you do is snap in the pre-measured snap pods and get going!
Leading figures in Britain's arts world have been told they must turn
their product into a «commodity» to justify continued funding.
The typical school kitchen simply is not geared to turning raw
product into daily meals on the scale Cooper operates, or employing efficiencies at every step the way, or deploying technology as Cooper does.
This keeps the stroller together while you're attending to your baby or trying to put
the product into your car with only one arm.
The unholy collusion between the beef industry and the USDA, which allowed BPI to mix their cheap
product into ground beef, without any requirement for labeling, is scandalous.
As he continues to grow, convert
the product into an activity table he can sit or stand at and play with everything it has to offer.
The spoon walker combines these two essential
product into one to give the right balance of uptake, playing and learning to walk.
The school district also allows frozen and canned local
product into their «Harvest of the Month» program to show students that local food comes in many forms — and doesn't always have to be fresh!
Never transfer a hazardous
product into a generic container or, worse yet, a food container, as this could lead to a dangerous mix - up.
I had no idea that you are actually supposed to mix
the product into the water, and not just use it like a regular soap!
Popping
this product into place takes a few easy steps and, once you get the hang of it, you can have it from packed - up to nap - ready in under a minute.
Every improvement has made a great
product into a must - have!
One of the reasons pregnant mamas love registering on Gugu Guru is that we simplify
every product into a very real life scenario and category.
This business supplies product to retail, manufacturing and wholesaling operations throughout Australia, while exporting a significant amount of
product into Asia and New Zealand.
Most packaging lines have three distinct sections: the front of the line (getting product and packaging materials to the line); middle of the line (getting
the product into the package); and end of the line (getting the packaged product ready for shipping).
Dr. Bronner's is launching its very first food
product into the UK market.
While it's difficult to find the time to prepare and simmer your own sauces these days, you can quickly turn a commercial
product into your own signature sauce by adding ingredients such as chiles, hot pepper sauces, ginger, or even fruits.
It is the most accurate way of packing
your product into secondary containers.
Stage 1: Simply enter
your product into any of the Quality Food Awards for the reduced fee of # 125 + VAT by 15th June
A specially - devised moving distribution system beneath the weigher transfers
the product into thermoformed twin - compartment trays, which are then top - sealed.
Fusion Tech Stuffing Tables are unique and robust tables designed to aid in stuffing
product into bags before entering a sealer or other packaging operation.
Typically placed on a line between a bag sealer and a boxing station, the bag flattening conveyor automates the bag flattening process to reduce operating expenses and fit more
product into boxes and cases.
Our bagging horns only require two operators: one to hold the bag onto the end of the horn, the other to push
the product into the bag.
Two - Person Operation One to attach and hold the bag on the horn, the other to stuff
your product into the bag.
Genesys Systems» client experienced an increase in product yields and a consistent flow of
product into their Tipper - Tie machines, reducing down time and operating expenses.
The chute helps direct
product into the shredder infeed.
Simply squeeze this single - ingredient
product into smoothies, tea or coffee for ample good fats and light coconutty flavor.
Mr Bourke said the company was still selling the same amount of
product into supermarkets but there was a shift from its premium Creative Gourmet brand to cheaper private - label foods, which it also sold into Coles but that earned slimmer margins.
Designed to attach to the end of a conveyor or table, these bagging horns provide an easy solution to stuffing
product into bags before entering a sealer.
Fusion Tech Boxing Tables provide an ergonomically safe working height for loading
product into empty boxes.
Here's a look at six new systems, each using a different technology to put
product into package.
Designed to optimizing the bagging process, these bagging stations provide an easy solution to stuffing
product into bags before entering a sealer.
Some require heavy lifting or awkward postures to get the final
product into its proper packaging — not the most ergonomically sound practices.
«We can divert some of our existing milk
product into it, but obviously we're looking at growing,» he said.
In Weighing Solutions, the company will unveil a 32 - head mix weigher from its RV range, capable of mixing up to eight different products for discharge into the same bag or for discharging a single
product into a high speed packaging machine, and therefore ideal for confectionery, nuts, frozen food or high - speed multi-compartment applications.
Fusion Tech bagging horns are designed to attach to the end of a conveyor or table, providing an easy solution to stuffing
product into bags before entering a sealer.
Whether that is... in our case with Bindaree Beef Group, getting
a product into a retail pack and shipped into China and then partnering up with someone who is best at hitting the distribution and sales.»
Pour the finished
product into a frosty mug and finish it off with crushed graham crackers and marshmallow.
«We're doing a lot of different promotional activities based on getting
our product into people's hands and having them actually hold a pouch and use it.»