Sentences with phrase «rrna nucleotide sequences»

There is no such «direct» evolution: animals, bacteria, and algae have a common ancestor from which they have diverged, as can be shown by aligning and comparing amino acid sequences of proteins and nucleotide sequences of homologous ribosomal RNA molecules that are found in both bacteria and vertebrates.

Microspheres are then able to use proteinoids as templates to make polynucleotides, which are themselves nonrandom because specific three - nucleotide sequences bind preferentially to specific amino acids.

In 1972 he and his team were the first to publish the nucleotide sequence of a complete gene.

Fiers investigated the nucleotide sequence of the hemagglutinin gene of this duck virus and found that it was indeed very closely related to the strain that started the 1968 Hong Kong outbreak.

Every tissue in an organism contains a variety of messenger RNA molecules, single - stranded nucleotide sequences bearing instructions for the making of specific proteins.

Which genes are activated and which are turned off is in part determined by a second tier of information which is superimposed on the nucleotide sequences that provide the blueprints for protein synthesis.

We elucidated the nucleotide sequence of a gene, and this was published in 1972.

It is a term of art in patent law that renders the claim «open - ended» so that it covers both the listed nucleotide sequence and, more importantly, the listed sequence in combination with additional sequences.

Since other scientists can easily and reliably duplicate an EST once provided with its nucleotide sequence, such a decision is hardly surprising.

Nucleotide sequence listings will be found to satisfy the written - description requirements, according to Doll.

This database is produced at National Center for Biotechnology Information (NCBI) as part of the International Nucleotide Sequence Database Collaboration, or INSDC.

Analysis of partial nucleotide sequences has enabled the team to refine our picture of the evolutionary history of cervids.

Zhang compared the DNA nucleotide sequence of the human version of ASPM to that of two of our great ape cousins, the chimpanzee and the orangutan, as well to more distantly related animals such as rhesus monkeys, seals, dogs, and hamsters.

Next they copied the promising RNA molecules using a technique that caused small mutations in their nucleotide sequences and let these mutated RNA molecules have another go at the reaction.

Bartlett and Davidson devised a technique called Forensically Informative Nucleotide Sequencing, or FINS, mainly for use in verifying that processed fish products are made of the species they claim to be.

A chromosome is, minimally, a very long, continuous piece of DNA, which contains many genes, regulatory elements and other intervening nucleotide sequences.

The four strains of the Ebola virus, however, are so varied that they do not share a 15 - nucleotide sequence.

A family of neuropeptide genes which includes the gene encoding ELH along with two additional genes encoding the A and B peptides thought to initiate the egg - laying process has been isolated and their nucleotide sequence has been determined.

This effort involves first generating lots of tiny, overlapping bits of DNA that must be assembled in the right order after their nucleotide sequences are determined.

Animals that share a recent common ancestor would have more nucleotide sequences in common than would more distantly related animals.

Rice University scientists have uncovered new details about how a repeating nucleotide sequence in the gene for a mutant protein may trigger Huntington's and other neurological diseases.

Where the Neanderthal had gene variants for a larger skull, for instance, Church would use MAGE to modify the nucleotide sequences that constituted those genes in one or more of the chunks of human DNA.

Telomeres are repetitive nucleotide sequences found at the end of chromosomes which protect them from deteriorating during the process of replication.

In an ambitious study, the authors attempt to trace drug resistance against all strains of the flu by using an extensive influenza virus database containing all known genetic sequence information (70,000 complete nucleotide sequences) for influenza strains.

Telomeres are stretches of protective, repetitive nucleotide sequences at the ends of chromosomes.

During development, chromosomes are subject to chemical changes that don't affect the nucleotide sequence but can turn genes on or off; the best known example is methylation, in which a methyl group is attached to specific DNA regions.

And since we know the nucleotide sequence of every known microRNA, all that is required is to prepare an anti-miR with a sequence that is exactly the opposite of the miR's,» he said.

Working with French composer Richard Krüll, the pair turned the complete nucleotide sequences of several microbe genes into compositions based on DNA bases: A (adenosine), C (cytosine), G (guanine), and Thymine (which they have translated to «Re,» or D).

«If only the nucleotide sequence is important to protein function, then the mice shouldn't care what protein they have,» Kashina said.

Notophthalmus viridescens, an urodelian amphibian, represents an excellent model organism to study regenerative processes, but mechanistic insights into molecular processes driving regeneration have been hindered by a paucity and poor annotation of coding nucleotide sequences.

Much of this DNA is no longer capable of moving, but is likely «auditioning» perhaps as a regulator of gene function or in homologous recombination, which is a type of genetic recombination where the basic structural units of DNA, nucleotide sequences, are exchanged between two DNA molecules to repair breaks in the DNA strands.

Nucleotide sequence of first 1000 bases of HIV - 1 strain HXB2 provirus.

These findings present a paradox, however, because latent virus can be of wild - type nucleotide sequence [33], and yet transcription is suppressed.

We previously showed that, in addition to the neural activity - inducible kakusei transcript, multiple neural activity - independent transcripts are constitutively expressed from the same kakusei locus, and the nucleotide sequences corresponding to +1925 b to +5160 b of the consensus kakusei cDNA are specifically contained in the neural activity - inducible kakusei - transcript [15].

Identification of physicochemical selective pressure on protein encoding nucleotide sequences.

Comparison of the structure and nucleotide sequences of Acks and kakusei cDNAs revealed that the nucleotide sequences corresponding to +1946 b to +5175 b of Acks cDNA was equivalent to the kakusei cDNA corresponding to the neural activity - inducible transcript (Figure 1A).

The primers and probes for quantitative RT - PCR were designed based on the nucleotide sequences corresponding to the above - mentioned putative neural activity - inducible Acks transcript (Figure 1A).

The isolation and nucleotide sequence of a cDNA encoding the T cell surface protein T4: a new member of the immunoglobulin gene family.

To obtain cDNA fragments of the kakusei homolog in Japanese honeybee, PCR was performed using a set of primers designed based on the nucleotide sequence of the European honeybee kakusei, 5 ′ - GGGGAAGCCAGGAGCCGCGGGTTTACAT - 3 ′ and 5 ′ - AGGCAACAGCACACCATGGGCCTTGGAT - 3 ′, with Ex Taq (Takara, Tokyo, Japan).

These findings suggest that the cloned Acks cDNA also contained nucleotide sequences corresponding to the putative neural activity - inducible Acks transcript, and that, like the kakusei - transcript, the Acks transcript functions as a non-coding RNA.

Development of a high - throughput sequence - independent amplification strategy for dsRNA viruses will increase our ability to sequence more diverse rotavirus strains, including clinical isolates from both humans and animals, regardless of their nucleotide sequence diversity.

The nucleotide sequences of Acks cDNA of approximately 7.1 kb in length shared approximately 85 % sequence identity with the European honeybee kakusei cDNA, and had additional unique sequences of approximately 700b at its 3 ′ end.

Their work arose out of a discovery in the late 1980s of neighboring bacterial DNA segments consisting of repeating nucleotide sequences, which flank short segments.

1981 - The EMBL Data Library is founded — the first central depository of nucleotide sequence data in the world (precursor to EMBL - EBI).

Research interests: The biology of pregnancy, Evolution of genes X environment interactions, Mammalian phylogenetics, Rates of nucleotide sequence evolution, The evolution of the brain, Primate evolutionary genetics

Genes with the product «methyltransferase» were all selected as nucleotide sequences.

Silence's specific siRNA molecules exhibit unique structural features which, irrespective of their individual nucleotide sequence, bar third parties from commercialising this type of molecule.

The goal of this project is to identify the specific nucleotide sequences and / or single nucleotide polymorphisms that are correlated with expression of virulence and disease via comparative genomic analysis between B. pseudomallei strains as well as between various bacteriophages harbored within B. pseudomallei.

The nucleotide sequences of the 16S — 23S rDNA spacers for the B. burgdorferi isolates analyzed in figure 1 were deposited in GenBank (accession numbers, AF139507 — AF139517).

A federal agricultural state of emergency has been declared, and the U.S. Department of Agriculture has contracted the Brazilian consortium, the Organization for Nucleotide Sequencing and Analysis (ONSA), to sequence the strain that causes this scourge.