Sentences with phrase «range unc»

Long - range unc - 9Δ:: gfp PCR products for micro-injections were similarly PCR - amplified from ligations using the UNC - 9A primer plus a primer specific to pPD95.77 (5» - TTGCTACAGGCATCGTGGTGTCACG - 3»).
a b c d e f g h i j k l m n o p q r s t u v w x y z