Sentences with phrase «real time instruction»

Not exact matches

For example, crews needing to repair a complex mud pump on an oil rig could simply activate step - by - step visual instructions right in front of their eyes, hands - free, and in real time.

To cater for these kinds of firms, Subramanian of ADCB says, regional solutions need to be tailored to ensure they are less IT - heavy product offerings, facilitate quicker decision - making, real - time messaging and advice, mobile authorizations and the processing of paper instructions, all areas where the Middle East banks believe they can excel.

You can actually make this with real pasta and add the cooked pasta into the sauce at the same time that the spaghetti squash is added in the instructions.

Seriously all internet fans should stop this rumor nonsense... like internet fans were 100 % roman reigns winning at wrestlemania but WWE just gave tight slap to all those fans... Rusev was included in US title match only to get pinned by Jinder mahal, thats the real reason... Merchandise sales was never a reason, Everyone know Vince has been hating rusev since that Ziggler Lana thing.Rusev doesn't follow vince instructions & goes out of storylines everytime... This time also it's a punishment for trash talk undertaker outside wwe tv.Cena did trash talk but it was on wwe & was approved by vince....

This system translates the EEG signals into navigation instructions and transmits them in real time to the robot.

They then instructed the robot to move, transmitting their instructions in real time via internet from their home country.

mRNA expression of DDX3 and p21waf1 / cip1 in adjacent normal liver tissues and HCC samples was examined using quantitative real - time PCR (LightCycler FastStart DNA Master SYBR Green I, Roche Applied Science, Mannheim, Germany) according to the instruction manual using the primer set DDX3 - 4987F, TTCTCAGATGTTTGTTGTGTGGATT; DDX3 - 5142R, AAACTTGCTCAAATGCTATTGCTG; p21 - F, AATCCCAGCTACTTGGAAGGC; and p21 - R, GCTGACTGCAACCTCTGCC.

CHIP — quantitative real - time fluorescence PCR (qPCR) was performed using Cell Signaling SimpleChIP Plus Enzymatic Chromatin IP Kit (# 9005) according to the manufacturer's instructions.

The Short Version: The Professional Wingman team gives singles step - by - step instructions and real - time feedback so they can successfully navigate any dating scenario.

The Short Version: The Professional Wingman team gives singles step - by - step instructions and real - time feedback so... (read more)

Digital learning can provide real - time data so teachers can differentiate instruction with laser - like precision.

Inherent within this shift is the need to re-evaluate the curriculum as the real - time web and information age present new challenges to instruction and student engagement.

In the work we have done most recently, in creating the online high school, we have taken the real - time video - conference based seminar as the main vehicle for instruction.

He successfully lobbied his principal to double the instructional time allotted for the subject and redesigned the math curriculum to emphasize the increasing use of technology, to meet all learning styles, and to provide instruction with a real - world...

Bringing a quantitative element into the process to enable big data analytics to measure instruction, retention, development, and generally bring a best - practices element right into the learning environment in real time; much more robust than end of year exams.

* Empower teachers, parents and leaders with secure, protected real - time data and analytics to adjust instruction, match the right interventions to the right students at the right time, and glean new insight into student learning.

In addition, tutors and master teachers use real - time data to challenge and support students with small - group and individualized instruction that not only leverages the technologies that students use but complements them as well.

How many times have you been in a situation where a manual or instruction makes perfect sense... until you have to actually do it for real?

When students are able to get foundational knowledge and skills through technology - based instruction, teachers can evolve their purpose in the classroom and focus their time on providing expert feedback on higher - order skills and tackling complex, real - world problems with their students.

He successfully lobbied his principal to double the instructional time allotted for the subject and redesigned the math curriculum to emphasize the increasing use of technology, to meet all learning styles, and to provide instruction with a real - world context.

Because Looplabs supports real - time collaboration, it allows for the real - time viewing of work along with guided instruction.

Our math experience at DreamBox provides ongoing formative assessment that is seamlessly integrated into instruction in real time giving teacher and learner the feedback they need for consistent and constant improvement.

In other words, the instruction adapts in real - time to each kids particular profile.

Students can't improve or become managers of their own learning without constant, real - time assessment and feedback, referred to in PBL instruction as assessment for learning, as opposed to assessment for school, district, or classroom accountability.

But in general, instruction is both lively and practical, such as in one classroom where a biology teacher, donning a lab coat, leads a lab on extracting DNA from strawberries, or a ninth - grade math class in which a teacher integrates a Texas Instruments navigator system into every part of her lesson; she has her class turn assignments in via a graphing calculator and checks for comprehension with every student in real time.

Shute argues the approach means schools no longer have to interrupt their teaching and learning to carry out testing - rather the stealth solution is a way of continuing to support «real - time, just - in - time instruction'to students.

It can enable personalized instruction, real - time assessments, collaborative relationships between learners and instructors, and improved access to educational opportunities.

The digital learning tools flooding schools come with a tantalizing promise: real - time feedback on what children know, combined with fingertip access to a dizzying array of tailored instructional materials, resulting in more customized instruction from teachers and a more personalized learning experience for each student.

They described efforts to provide multiple avenues for students to access content, strategies for using audio and video to scaffold independent learning, opportunities to adapt instruction based on real - time data, and the chance to engage in more meaningful face - to - face conversations.

Several of the schools include synchronous (real - time) as well as asynchronous instruction in their programs.

Teachers individualize instruction using real - time data.

«Since NCLB came into play, data has been driving instruction whether or not the teachers were able to best determine how to calculate and apply the data in real - time.

In this way, their use of technology was grounded in authentic writing instruction, and they could see how the campers benefitted in real time.

Further, Dreyer says she and Guttentag quickly identified the need to weave synchronous instruction — real - time communication between teachers and students — into all courses, long before it was a regular feature of online learning.

As Michael Fullan points out in his article entitled, «Choosing the Wrong Drivers for Whole School Reform,» real reform takes place when schools have the time and resources to focus on student learning, instruction, and assessment.

[i] Multi-Classroom Leaders are former high - performing teachers who now support teachers through Real Time Teacher Coaching for Management (RTTC - M); Real Time Teacher Coaching for Instruction (RTTC - I); curriculum support and content area specialization.

This intentionality gives teachers the tools they need when they need them, and Real Time Teacher Coaching for Instruction (RTTC - I), supported by CT3, ensures coaches can quickly grow teachers» skills in the use of the strategy so that they can capture the rich trove of information it provides about student learning.

Through the platform and Galileo Dashboards, teachers, specialists, and administrators have real - time access to a continuous portrait of instruction and student learning.

The school administrators and teachers, too, can access their own data and build their own reports so they can monitor their students» progress and make real - time adjustments to their instruction.

DreamBox Learning is an adaptive, online K - 8 math instructional program designed to complement classroom practice, while empowering educators with real - time data to differentiate instruction and personalize learning.

Accomplished formative assessment teachers work fluently and automatically within the current instructional context to address students» immediate learning needs in real time — rapidly processing evidence of student thinking and learning, automatically considering the learning targets, then making advantageous decisions about the next steps of instruction to move learning forward, sometimes with a plan B or even C in mind.

Carrie also shared three effective teaching strategies taught in Real Time Teacher Coaching to provide instant data for teachers seeking to improve their instruction.

These connections will deliver real - time, actionable analytics that educators will use to drive continuous improvement in student learning and instruction.»

Agile Assessment equips educators with high - quality, next - generation formative assessments, real - time reporting to inform instruction, and high - yield strategies to differentiate instruction and enhance achievement.

CT3 is redefining the nature of transformative professional development with our unique training model that delivers feedback at the point of instruction, Real Time Teacher Coaching, and with our research - validated method for classroom management, the No - Nonsense Nurturer approach.

During our work, teachers learned about the concept of having a «growth mindset» and participated in Real Time Teacher Coaching, where they received coaching at the point of instruction.

District level educators can analyze sweeping patterns and trends while instructional leaders can employ fast and flexible reports to shape curriculum and instruction in the classroom in real - time

With MyFlexPD, educators use real - time student performance data to make more personalized professional learning choices, deepen content knowledge, and inform classroom instruction.

Optionally, assign a simple 1 - 4 star rating to student work to get a real - time understanding of how students are progressing towards key curriculum objectives, inform instruction and save time on reporting.

Citing two earlier cases that forced changes in state laws regarding students» rights to quality education through money spent and time of instruction provided, as well as evidence in Vergara, he said the plaintiffs «have proven, by a preponderance of the evidence, that the Challenged Statutes impose a real and appreciable impact on students» fundamental to quality of education and that they impose a disproportionate burden on poor and minority students.»