Sentences with phrase «rhesus cxcr4»

Briefly, the purified genomic DNA was used as a template to amplify a fragment of the cxcr4 gene using the specific primers (human CXCR4: 5 ′ - CAACCTCTACAGCAGTGTCCTCATC -3 ′ and 5 ′ - GGAGTGTGACAGCTTGGAGATG -3 ′; rhesus CXCR4: 5 ′ - GGTGGTCTATGTTGGAGTCTGG -3 ′ and 5 ′ - GGAGTGTGACAGCTTGGAGATG -3 ′) in the presence of a 32P - dATP and dCTP.

We designed ZFNs specific to the human and rhesus CXCR4 and CCR5 genes using a previously described approach [29].

Not exact matches

One ZFN pair was used to target both the human and rhesus macaque CXCR4 genes since the 24 bp target sequences are identical.

To study this in the most rigorous way possible, we have explored the possibility of targeting CCR5 and CXCR4 in CD4 + T cells derived from rhesus macaques.

Utilizing a range of MOIs of 600, 1000, and 2000 we observed mean ccr5 and cxcr4 disruption levels of 19.6 % and 14.0 %, respectively (Figure 7), which suggests that adoptive therapy of cells modified with ZFNs is feasible to model in rhesus macaques.