Sentences with phrase «ribosomal protein»

These findings may help explain why some people with mutations in certain ribosomal protein genes develop conditions such as Diamond - Blackfan anemia — a blood disorder in which the bone marrow doesn't make enough red blood cells — but don't have problems in other body tissues, Ware says.

Following a lead from these experiments, we obtained direct evidence for differential stoichiometry among core ribosomal proteins in unperturbed wild - type cells.

Dennis, P. P., & Bremer, H. Differential rate of ribosomal protein synthesis in Escherichia coli B / r.

Zhang Y, Wolf GW, Bhat K, Jin A, Allio T, Burkhart WA and Xiong Y. Ribosomal protein L11 negatively regulates oncoprotein MDM2 and mediates a p53 - dependent ribosomal - stress checkpoint pathway.

In a recently published work, the researchers have shown how ribosomal protein S1 plays a crucial role when the viral Qβ genetic material is to be distinguished from the genetic material of the coli bacteria prior to the replication process.

Genes encoding ribosomal proteins, DNA replication and repair machinery, oxidative stress, and purine biosynthesis were differentially expressed in Wolbachia during the development of B. malayi female worms, suggesting a role of the bacteria in worm reproduction.

Of the 80 ribosomal proteins examined, 31 changed protein levels in at least one cell type, Barna said.

The Chr 16 segment contains about two thirds of the human Chr 21 homologues in the mouse, from mitochondrial ribosomal protein L39 (Mrpl39) gene to the distal telomere.

The ZNF804A protein and ribosomal protein RPSA, co-localized in mouse nerve cells, were stained with fluorescent dyes and merged into a single image.

«We have ample evidence that hundreds of the oldest ribosomal proteins still start with a valine or a leucine code and do not have the codon for methionine in the DNA,» Duax said, referring to proteins found in basic cell components called ribosomes.

However, these findings are incompatible with the results of efforts to locate individual ribosomal proteins by immune electron microscopy and triangulation with interprotein distance measurements.

Tissue - specific mRNAs are isolated following ribosome affinity purification of tissue - specific tagged ribosomal proteins followed by polysomal profiling.

The blots were re-hybridized with a probe for the S26 ribosomal protein to control for loading.

«One striking example is the link between ribosomal protein Rpl26 and body weight,» says Hao Li, first author of the paper.

Biological Function of Ribosomal Protein L10 on Cell Behavior in Human Epithelial Ovarian Cancer Jimin Shi, Lingyun Zhang, Daibing Zhou, Jinguo Zhang, Qunbo Lin, Wencai Guan, Jihong Zhang, Weimin Ren, Guoxiong Xu J. Cancer 2018; 9 (4): 745 - 756.

Therefore, Teitell's group opted to further modify their constructs with a 3 ′ - UTR mitochondrial targeting sequence (MTS) from human mitochondrial ribosomal protein S12 — the same essential approach used to optimize the import of allotopically - expressed proteins by Dr. Marisol Corral - Debrinski, (3,4) and subsequently advanced for multiple additional ETS subunit proteins by Dr. Matthew O'Connor's group at the SENS Foundation Research Center (RC).

Ribosomal protein S24 (RPS24) gene served as an internal control for quantitation using the primer set TGGCTTTGGCATGATTTATGAT and CTTTTTGCCAGCACCAACATT.

In vivo studies have previously shown that Saccharomyces cerevisiae ribosomal protein (RP) gene expression is controlled by the transcription factor repressor activator protein 1 (Rap1p) in a

Specifically, we have shown that the condensin subunit Cnd2 binds directly to the most important general transcription factor, the TATA box - binding protein TBP, and that TBP recruits condensin molecules onto RNA polymerase III - transcribed genes and highly active Pol II - transcribed genes (many ribosomal protein genes) through the Cnd2 - TBP interaction (Figure A).

mTORC1 is the central component of the insulin - signaling cascade [insulin / insulin - like growth factor (IGF)-- phosphatidylinositol 3 - kinase (PI3K) pathway)(Fig. 1) that regulates protein synthesis and mRNA translation through 2 primary mechanisms: 1) inactivation of the repressor of mRNA translation, eukaryotic translation initiation factor 4E - binding protein 1 (eIF4E - BP1), and 2) the activation of 70 - kDa ribosomal protein S6 kinase.

The synthesis of eukaryotic ribosomal subunits requires the concerted activity of ~ 200 assembly factors that drive ribosome biogenesis through a series of pre-rRNA cleavage, folding and modification reactions, which are coupled to the incorporation of ribosomal proteins (Henras et al., 2015; Woolford and Baserga, 2013; Zemp and Kutay, 2007).

p70S6K enhances translation of mRNAs encoding ribosomal proteins and elongation factors [38] and has been proposed as a «surrogate» marker associated with rates of muscle protein synthesis [39]--[42].

Ribosomal protein genes are clustered in the same order in the mitochondrial genome as in bacterial genomes.

In eukaryotes, they consist of a small 40S and large 60S subunit, which carry the decoding and peptidyl transferase activity, respectively, and together comprise four ribosomal (r) RNAs (18S, 5.8 S, 25S and 5S rRNA) and 78 ribosomal proteins in yeast.

Domain II of EF - P interacts with the ribosomal protein L1, which results in the largest movement of the L1 stalk that has been observed in the absence of ratcheting of the ribosomal subunits.

The team then examined the ribosomal proteins found in each type of cell.

For instance, ribosomes containing the ribosomal protein RPS25 build all of the proteins involved in processing vitamin B12, Barna and colleagues reported July 6 in Molecular Cell.

The replicase can not cope with this task on its own, so it hijacks three «helpers» from the host's own proteins namely the ribosomal protein S1, EF - Tu and EF - Ts, which all usually play important roles for the host cell's protein machine.

The values were normalized to the expression of the gene ribosomal protein, large, P0 (Rplp0) as an internal control.

5 ′ - Terminal oligopyrimidine tract mRNAs exclusively encode components of the translation machinery, including all ribosomal proteins and elongation factors (34).

Here, we provide evidence that mTOR signaling phosphoproteins, including mTOR, eukaryotic initiation factor 4E — binding protein - 1, p70S6K, and ribosomal protein S6, are highly phosphorylated in ALK + ALCL cell lines and tumors.

mTOR - raptor complex (composed of mTOR, raptor, and GβL) is sensitive to rapamycin and regulates cell growth, in part, by phosphorylation of the ribosomal protein S6 (rpS6) kinase (p70S6K or S6K1) and subsequent phosphorylation of rpS6 to stimulate protein translation and ribosome biogenesis (9, 10).

More than half of children with DBA have mutations in a ribosomal protein gene, and mutations at least 11 such genes have been linked to DBA.

It has also been reported that the ribosomal protein L11 interacts with oncoprotein HDM2 and inhibits the function of HDM2, thus leading to the stabilization and activation of p53 [20 - 22].

Regulation of HDM2 activity by the ribosomal protein L11.

In E. coli, the four ribosomal proteins of the alpha operon are translationally repressed by ribosomal protein S4, one of the proteins encoded in the operon.