mTORC1 is the central component of the insulin - signaling cascade [insulin / insulin - like growth factor (IGF)-- phosphatidylinositol 3 - kinase (PI3K) pathway)(Fig. 1) that regulates protein synthesis and mRNA translation through 2 primary mechanisms: 1) inactivation of the repressor of mRNA translation, eukaryotic translation initiation factor 4E - binding protein 1 (eIF4E - BP1), and 2) the activation of 70 - kDa
ribosomal protein S6 kinase.
IGF - I is perhaps the most important mediator of muscle growth and repair (49), possibly through the use of protein kinase B — mechanistic target of rapamycin — p70
ribosomal protein S6 kinase signaling.
Specifically, we have shown that the condensin subunit Cnd2 binds directly to the most important general transcription factor, the TATA box - binding protein TBP, and that TBP recruits condensin molecules onto RNA polymerase III - transcribed genes and highly active Pol II - transcribed genes (many
ribosomal protein genes) through the Cnd2 - TBP interaction (Figure A).
Regulation of HDM2 activity by
the ribosomal protein L11.
Abbreviations: Aβ, amyloid β - peptide; AD, Alzheimer's disease; ALS, amyotrophic lateral sclerosis; Ambra1, activating molecule in Beclin -1-regulated autophagy; AMPK, AMP - activated protein kinase; APP, amyloid precursor protein; AR, androgen receptor; Atg, autophagy - related; AV, autophagic vacuole; Bcl, B - cell lymphoma; BH3, Bcl - 2 homology 3; CaMKKβ, Ca2 + - dependent protein kinase kinase β; CHMP2B, charged multivesicular body protein 2B; CMA, chaperone - mediated autophagy; 2 ′ 5 ′ ddA, 2 ′, 5 ′ - dideoxyadenosine; deptor, DEP - domain containing mTOR - interacting protein; DRPLA, dentatorubral pallidoluysian atrophy; 4E - BP1, translation initiation factor 4E - binding protein - 1; Epac, exchange protein directly activated by cAMP; ER, endoplasmic reticulum; ERK1 / 2, extracellular - signal - regulated kinase 1/2; ESCRT, endosomal sorting complex required for transport; FAD, familial AD; FDA, U.S. Food and Drug Administration; FIP200, focal adhesion kinase family - interacting protein of 200 kDa; FoxO3, forkhead box O3; FTD, frontotemporal dementia; FTD3, FTD linked to chromosome 3; GAP, GTPase - activating protein; GR, guanidine retinoid; GSK3, glycogen synthase kinase 3; HD, Huntington's disease; hiPSC, human induced pluripotent stem cell; hVps, mammalian vacuolar protein sorting homologue; IKK, inhibitor of nuclear factor κB kinase; IMPase, inositol monophosphatase; IP3R, Ins (1,4,5) P3 receptor; I1R, imidazoline - 1 receptor; JNK1, c - Jun N - terminal kinase 1; LC3, light chain 3; LD, Lafora disease; L - NAME, NG - nitro - L - arginine methyl ester; LRRK2, leucine - rich repeat kinase 2; MIPS, myo - inositol -1-phosphate synthase; mLST8, mammalian lethal with SEC13 protein 8; MND, motor neuron disease; mTOR, mammalian target of rapamycin; mTORC, mTOR complex; MVB, multivesicular body; NAC, N - acetylcysteine; NBR1, neighbour of BRCA1 gene 1; NOS, nitric oxide synthase; p70S6K,
ribosomal protein S6 kinase - 1; PD, Parkinson's disease; PDK1, phosphoinositide - dependent kinase 1; PE, phosphatidylethanolamine; PI3K, phosphoinositide 3 - kinase; PI3KC1a, class Ia PI3K; PI3KC3, class III PI3K; PI3KK, PI3K - related protein kinase; PINK1, PTEN - induced kinase 1; PKA, protein kinase A; PLC, phospholipase C; polyQ, polyglutamine; PS, presenilin; PTEN, phosphatase and tensin homologue deleted from chromosome 10; Rag, Ras - related GTP - binding protein; raptor, regulatory - associated protein of mTOR; Rheb, Ras homologue enriched in brain; rictor, rapamycin - insensitive companion of mTOR; SBMA, spinobulbar muscular atrophy; SCA, spinocerebellar ataxia; SLC, solute carrier; SMER, small - molecule enhancer of rapamycin; SMIR, small - molecule inhibitor of rapamycin; SNARE, N - ethylmaleimide - sensitive factor - attachment protein receptor; SOD1, copper / zinc superoxide dismutase 1; TFEB, transcription factor EB; TOR, target of rapamycin; TSC, tuberous sclerosis complex; ULK1, UNC -51-like kinase 1; UVRAG, UV irradiation resistance - associated gene; VAMP, vesicle - associated membrane protein; v - ATPase, vacuolar H + - ATPase; Vps, vacuolar protein sorting
Zhang Y, Wolf GW, Bhat K, Jin A, Allio T, Burkhart WA and Xiong Y.
Ribosomal protein L11 negatively regulates oncoprotein MDM2 and mediates a p53 - dependent ribosomal - stress checkpoint pathway.
More than half of children with DBA have mutations in
a ribosomal protein gene, and mutations at least 11 such genes have been linked to DBA.
In vivo studies have previously shown that Saccharomyces cerevisiae
ribosomal protein (RP) gene expression is controlled by the transcription factor repressor activator protein 1 (Rap1p) in a
Ribosomal protein S24 (RPS24) gene served as an internal control for quantitation using the primer set TGGCTTTGGCATGATTTATGAT and CTTTTTGCCAGCACCAACATT.
Therefore, Teitell's group opted to further modify their constructs with a 3 ′ - UTR mitochondrial targeting sequence (MTS) from human mitochondrial
ribosomal protein S12 — the same essential approach used to optimize the import of allotopically - expressed proteins by Dr. Marisol Corral - Debrinski, (3,4) and subsequently advanced for multiple additional ETS subunit proteins by Dr. Matthew O'Connor's group at the SENS Foundation Research Center (RC).
Here, we provide evidence that mTOR signaling phosphoproteins, including mTOR, eukaryotic initiation factor 4E — binding protein - 1, p70S6K, and
ribosomal protein S6, are highly phosphorylated in ALK + ALCL cell lines and tumors.
DNA repair efficiency in transgenic mice over expressing
ribosomal protein S3.
Biological Function of
Ribosomal Protein L10 on Cell Behavior in Human Epithelial Ovarian Cancer Jimin Shi, Lingyun Zhang, Daibing Zhou, Jinguo Zhang, Qunbo Lin, Wencai Guan, Jihong Zhang, Weimin Ren, Guoxiong Xu J. Cancer 2018; 9 (4): 745 - 756.
For expression analysis in mice, we used microarray data as described above to select two internal control genes, cyclophilin B (Cphn2) and
ribosomal protein S3 (Rps3).
The blots were re-hybridized with a probe for the S26
ribosomal protein to control for loading.
The replicase can not cope with this task on its own, so it hijacks three «helpers» from the host's own proteins namely
the ribosomal protein S1, EF - Tu and EF - Ts, which all usually play important roles for the host cell's protein machine.
These findings may help explain why some people with mutations in certain
ribosomal protein genes develop conditions such as Diamond - Blackfan anemia — a blood disorder in which the bone marrow doesn't make enough red blood cells — but don't have problems in other body tissues, Ware says.
The ZNF804A protein and
ribosomal protein RPSA, co-localized in mouse nerve cells, were stained with fluorescent dyes and merged into a single image.
Domain II of EF - P interacts with
the ribosomal protein L1, which results in the largest movement of the L1 stalk that has been observed in the absence of ratcheting of the ribosomal subunits.
Genes encoding
ribosomal proteins, DNA replication and repair machinery, oxidative stress, and purine biosynthesis were differentially expressed in Wolbachia during the development of B. malayi female worms, suggesting a role of the bacteria in worm reproduction.
Of the 80
ribosomal proteins examined, 31 changed protein levels in at least one cell type, Barna said.
The team then examined
the ribosomal proteins found in each type of cell.
«We have ample evidence that hundreds of the oldest
ribosomal proteins still start with a valine or a leucine code and do not have the codon for methionine in the DNA,» Duax said, referring to proteins found in basic cell components called ribosomes.
However, these findings are incompatible with the results of efforts to locate individual
ribosomal proteins by immune electron microscopy and triangulation with interprotein distance measurements.
Tissue - specific mRNAs are isolated following ribosome affinity purification of tissue - specific tagged
ribosomal proteins followed by polysomal profiling.
Following a lead from these experiments, we obtained direct evidence for differential stoichiometry among core
ribosomal proteins in unperturbed wild - type cells.
O - GlcNAc cycling enzymes associate with the translational machinery and modify core
ribosomal proteins.
In E. coli, the four
ribosomal proteins of the alpha operon are translationally repressed by ribosomal protein S4, one of the proteins encoded in the operon.
In eukaryotes, they consist of a small 40S and large 60S subunit, which carry the decoding and peptidyl transferase activity, respectively, and together comprise four ribosomal (r) RNAs (18S, 5.8 S, 25S and 5S rRNA) and 78
ribosomal proteins in yeast.
High levels of gene expression were found in both strains for genes involved in growth, energy and respiration (e.g.,
ribosomal proteins, ATP synthase, pseudoazurin), and the C - 1 metabolic carbon such as methanol dehydrogenase, ribulose monophosphate enzymes (D - arabino -3-hexulose 6 - phosphate formaldehyde - lyase, 6 - phospho -3-hexuloisomerase), formaldehyde activating enzymes (Data S6, Fig.
Not exact matches
There is no such «direct» evolution: animals, bacteria, and algae have a common ancestor from which they have diverged, as can be shown by aligning and comparing amino acid sequences of
proteins and nucleotide sequences of homologous
ribosomal RNA molecules that are found in both bacteria and vertebrates.
Ribosomes, the cellular factories that manufacture
proteins, contain both RNA and
protein, but exactly how all of the different
ribosomal components contribute to
protein synthesis is still not clear.
Splicing of the Tetrahymena
ribosomal RNA precursor is mediated by the folded structure of the RNA molecule and therefore occurs in the absence of any
protein in vitro.
Now, as Thomas Cech explains in his Perspective, atomic resolution of the structure of the large
ribosomal subunit reveals that, as predicted by those convinced of a prebiotic RNA world, RNA is the catalytic component with
proteins being the structural units that support and stabilize it (Ban et al., Nissen et al., Muth et al.).
This set includes various ribosome builders, as well as other
proteins that process and transcribe
ribosomal RNA, a necessary step before the ribosomes can be assembled and pushed out of the nucleolus.
Both substrate analogs are contacted exclusively by conserved
ribosomal RNA (rRNA) residues from domain V of 23S rRNA; there are no
protein side - chain atoms closer than about 18 angstroms to the peptide bond being synthesized.
tiRNA is a type of small RNA that suppresses global
protein synthesis, while rRNA or
ribosomal RNA is a type of RNA molecule that enhances
protein synthesis.
Moreover, a funnel - shaped pore in the Sec61 oligomer aligned with the exit of a tunnel traversing the large
ribosomal subunit, strongly suggesting that both structures function together in the translocation of
proteins across the endoplasmic reticulum membrane.
The cells somehow managed to be highly proliferative, made more
ribosomal RNA, and synthesized more
protein, all with fewer copies of
ribosomal DNA.
In Escherichia coli, the small
ribosomal subunit has a sedimentation coefficient of 30S, and consists of a 16S RNA molecule of 1541 nucleotides complexed with 21
proteins.
While E. coli bacteria are part of the human gut flora and usually not pathogenic, the strains classed together as EHEC produce a dangerous Shiga toxin that enters the cells in the gut and inhibits
protein synthesis by cleaving
ribosomal RNA.
One well - accepted effort compares the nucleic acid sequences that code for
ribosomal RNA and a few
proteins in many different organisms.
The sequence is called
ribosomal RNA, which is used by cells to create
protein.
Attempts to decode and translate such «nonstop - mRNAs» leads to a complete stalling of the
ribosomal machinery, resulting in effectively blocking continued
protein synthesis.
The branch uniting the fungi and animals is well - supported based on a number of molecular phylogenetic datasets, including the nuclear small subunit
ribosomal RNA gene (Wainwright et al., 1993; Bruns et al. 1993), unique and shared sequence insertions in
proteins such as elongation factor 1α (Baldauf and Palmer, 1993), entire mitochondrial genomes (Lang et al., 2002), and concatenated
protein - coding genes (Steenkamp et al., 2006).
Ribosomal biogenesis and the translation of
proteins included within their processing, folding and degradation have shown to be activated during the night and controlled by the circadian clock in past studies (Jouffe et al., 2013; Panda et al., 2002).
This reporter employs a tandem array of internal
ribosomal entry sites to drive translation of an enhanced Yellow Fluorescent
Protein (Venus) from the transcript that normally encodes for the early endodermal marker Hex.
For this, we co-expressed PLE and the fluorescent
protein mCherry in DA neurons using a Cre - dependent recombinant adeno - associated viral vector, rAAV2 / 1 - Synapsin:: FLEX - rev - PLE - 2a - mCherry (2a:
ribosomal skip sequence [Donnelly et al., 2001]-RRB- that was targeted unilaterally into the VTA of Slc6a3Cre mice, a mouse line that selectively expresses Cre - recombinase in DA neurons (Zhuang et al., 2005).