Sentences with phrase «rounds of amplification»

Adenovirus was produced by transfecting adenoviral expression vector into E1 - complemented cell line 293A and performing successive rounds of amplification until high titer was achieved.

First, they sheared DNA into fragments that were a few kilobases long, ligated adapters to the ends of each fragment, and did a round of amplification.

Not exact matches

After only two such rounds of injection and amplification, a handful of variants emerged as those that were best at crossing the blood - brain barrier and entering astrocytes.

Next, 5 µl of the transcribed cDNA were used for the first round of PCR amplification with primers 419F (5 ′ - ATCAGTTAACCTACCCGAGTCGGAC - 3 ′) and 1154R (5 ′ - GCCGCCTCTTCTTCATTGTTCTC - 3 ′)[14] and HotStart - IT FideliTaq Master Mix (USB) with the recommended component volumes.

Nested PCR was performed under the same conditions for 45 amplification cycles with 5 µl of the first round PCR product and two different primer pairs, Gag - I - F (5 ′ - TCTCGAGATCATGGGACAGA - 3 ′) and Gag - I - R (5 ′ - AGAGGGTAAGGGCAGGGTAA - 3 ′) or NP116 (5 ′ - CATGGGACAGACCGTAACTACC - 3 ′) and NP117 (5 ′ - GCAGATCGGGACGGAGGTTG - 3 ′), respectively, both of which have been shown to detect both XMRV and MLV gag sequences [13].

The resulting first strand cDNA products were poly G - tailed followed by 30 rounds of PCR amplification using a single primer.