Sentences with phrase «see the project here»

He is not what you see projected here often, he is more what you would want him to be.

I would like to see a project here in the midwest, which is very average geothermally -(you have to go down about 10 kilometers to get 200 degrees C)-- a sucessful project here would show that plenty of energy is available everywhere - a city could become energy independent — energy would no longer be traded internationally.

Not exact matches

Walk around any floor of the company's plus - sized headquarters in Seattle, and you'll see blackboards and posters touting the number of volunteer hours a particular team of employee volunteers has put in on a particular project, or the current level of the Partner (employee) Cup Fund, an employee initiative whose value is in financially helping partners in need, including this formerly homeless barista, whose story I tell here.

Beyond that, people also get unlimited access to a variety of «on - net» resources ranging from news to local e-government services to business and educational tools (you can see an example of a Project Isizwe portal here).

It's helpful here to compare Apple to Google and its parent company, Alphabet, which is widely seen as a leader in investing money in ambitious long - term «moonshot» projects.

The Trans Mountain Expansion Project is still before the National Energy Board (NEB)(see the comment by Kirk Lambrecht QC here) and all the while spawning lots of litigation, some in the Federal Court of Appeal and some in the provincial superior courts.

When the Joint Review Panel's report for the Northern Gateway Project (the NGP Report) was first released, I knew that exam marking and other commitments would prevent me from posting a timely comment (in contrast, see here and here).

To find out how Floship can ease the challenge of shipping your projects, click here to see how our crowdfunding logistics can help you.

The operative word here is only, I have seen far too many causalities where the projected numbers have looked fantastic and people invested without bothering to understand business and the story have had miserable returns What to do when you are really optimistic about future of the company want your customers to buy?

Certainly the Japanese, so its all being done so — with the — Donald Trump wanting to turn around the trade deficit, you can't help but say hey maybe they are actually onto something because they have an independent central bank well --(unintelligible) the independent central bank that goes upon its course based on what its seeing here you know based on domestic economic activity, while everybody else is setting it to international standards then tariffs become the — I guess the alternative especially when the feds is raising the interest rates and they're the only central bank really raising interest rates... I know... the bank of England went half a basis point, quarter basis point and they are project to go a quarter basis point tomorrow which we will see.

«Within a year we will see community owned solar energy projects in B.C., the partnership we have created here is helping to initiate the second phase of the solar revolution in British Columbia.»

(See an example of the report you'll receive when your projects are ready here.)

Unlike Pilgrim, with its several moments of intense oneness with nature, or Holy the Firm, with its more complex treatment of nature as a site of worship, Dillard here is bound by the project of the book, which has to do with human design and artifice, to see how far she can go in resisting all humanizing of nature.

On a different note, if you are following me on social media you may know I'm taking part in 52 week photography challenge, this week's theme was B&W, you can see latest images from the project here.

I think most reasonable punters on here can see Arsenal embarking on a 3 year project here to narrow the quality gap — the gung - ho plastics will demand PL / UCL titles this season hence all the shouting.

See where we currently have Davis projected in the Wolverines» lineup here.

I see some on here try to project their wider gripes with AFC in general and AW in particular by trying to see things that aren't there — ie Alexis being unhappy.

There's lots I'm excited about trying out in here, but the boys saw the book and are begging to make one particular project for their sister's birthday.

While this list is in flux, click here to see state reports of API's Parent Support Deserts specific to Attachment Parenting infant - feeding support in the United States as spring 2014, as well as read more details about the Parent Support Deserts project.

I have two Shivaya - yarn projects on the needles now, so you'll be seeing more of their work here soon.

You can see a slideshow of more photographs from the project here.

Baby Finn's nursery is featured on Project Nursery and you can see where to purchase some of the adorable decor here.

And then I come home and see the beauty of our culturally diverse neighborhood; projects yes, but a dozen countries represented, children tearing about in the nearby parks hollering at each other in a dozen different languages, and I know our multi-cultural-ministry hearts are planted here for a reason.

We did visit a local school here and saw their «science fair» but it seemed to consist of rather basic projects with lots of printouts from the Internet and CD encyclopedias, with no research or experiments or anything other than a display that looked nice.

Take a moment to browse through these projects and see if any of the crafts here spark your creativity.

«We've seen students really gravitate towards the water out here and fill up their cups right before and after lunch to hydrate» says Burt Cowgill, the project manager.

Hi brasherhill 7944470, To see the pattern please click the link that says «Click here for project instructions» located just under the skill level.

Hey kids, long time no see — whew, it's been a time down here in the e.politics bunker the past three weeks, with major projects demanding serious attention at the day job, a little love for old clients at night, and a few thousands words due to ClickZ «s Kate Kaye for a project...

Hey kids, long time no see — whew, it's been a time down here in the e.politics bunker the past three weeks, with major projects demanding serious attention at the day job, a little love for old clients at night, and a few thousands words due to ClickZ «s Kate Kaye for a project she's putting together.

The projects and progress I have seen in Yola along with the reports and presentations made here have given me encouragement on the future of the State.

As local governments and school districts here in New York now deal with a tight 2 percent cap on property tax levies, it will be interesting to see how municipalities turn to revenue raisers to fund complex projects.

«Here we are, making sure that we put things in order so that we can see the terminal point of that project.

Here's a few stories, opinion pieces, and quotes, floating around the Web: Bronx BP Ruden Diaz, Jr. released a statement saying, «I am proud of the members of the Bronx City Council delegation for standing together and voting against this development project, and I am happy to see that so many City Council members from other boroughs were willing to join us.»

«I see a lot of friends of cycling here, starting with the County Executive who has been completely supportive of promoting safe cycling in this county as exemplified by this project,» Hermann said.

But on balance, Long sees working with undergraduate students, instead of graduate students and postdocs, as an advantage: «Because their lives aren't dependent on it if a project fails, we can do all kinds of crazy stuff here.

To see what sunspots looks like using modern instrumentation, here are two images of the sun's photosphere, taken by the Solar and Heliospheric Observatory (a joint project of NASA and the European Space Agency).

The Human Genome Project produced reams of data that look like this: TCGGGAAATTCGATCCCCAAAATTCTA, etc. (You can see genetic sequences online here.)

What a great Site, and its great to see SENS the first project, here, of course I had to back it.

For more on the importance of fiber and gut pH, see Human Food Project founder Jeff Leach's blog posts here and here.

I used a striped taper candle from a DIY project, you can see how I made it here.

And I'd love to see some of your DIY projects here < 3 Green Fashionista

I have made little candle holders before using glitter, which you can see here, so with this project I wanted to make something different and bit more practical..

I'm delighted to be here and I saw so many inspiring projects.

Current projects can be seen here.

To see more DIY project categories, click on the links here: DIY Projects for your home Christmas & Holiday Crafts Gardening Halloween Mantels True Value DIY Blog Squad Posts

I have had so much fun so far sharing my projects with you all, and I can't wait to see where it will all go next from here.

I was also so busy with my own blog and some home renovation projects that I missed many of your wonderful posts, so I can't wait to see them all here!

I also love using this brass and glass tiered tray around the house for different projects as well (you can see here & here where I used it for other projects)... it's so versatile and can go in any space.

To see projects from previous months, click here.

See if there's a project here that can inspire you to make something for the fall: