Sentences with phrase «sequencing projects like»

This discriminatory power will only increase as ambitious large - scale sequencing projects like CCDG make their data publicly available.

Not exact matches

«Having the genome sequence is like having part of the instruction manual,» says study author Richard Wilson of Washington University in Saint Louis (W.U.), echoing the famous 2000 comment of then Human Genome Project leader Francis Collins, who called knowledge of our genome a «glimpse of our instruction book.»

Large - scale genome sequencing efforts, like the Human Microbiome Project, have focused on the community of microorganisms that live in the human gut.

Others, like futurist and tech guru Esther Dyson, are having parts of their genomes sequenced in a project led by geneticist George Church of Harvard University and MIT.

Like the rat sequencing project (ScienceNOW, 5 March), it will include Celera Genomics of Rockville, Maryland, and feature unrestricted public access to data.

The top image of a flight simulation video game reflects one application for Lumitrack, which enables high - speed, high - precision tracking by projecting a barcode - like pattern, or m - sequence, over an area (pictured above).

The Human Genome Project produced reams of data that look like this: TCGGGAAATTCGATCCCCAAAATTCTA, etc. (You can see genetic sequences online here.)

Large - scale sequencing efforts like the 1,000 Genomes Project and The Cancer Genome Atlas now consider BAM the standard format for data exchange.

The 16 mm blowup sequences look more virtuoso than ever before, their influence on stuff like Ruggero Deodato's Cannibal Holocaust and even The Blair Witch Project brought into finer relief as a result.

Considering its notoriously troubled history — the $ 175 million project, directed by first - timer Carl Rinsch, went into production almost three years ago — some blatant re-cutting is expected; the Dejima episode, where Ôishi goes to rescue Kai from Dutch slave traders, feels like a severely shortened version of a longer sequence.

In an introductory company presentation sequence that Bong directed like a three - act ballet, Lucy walks reporters through the firm's newest endeavor, Super Pig Project, where 26 farmers around the world are tasked to raise their own «revolution of the livestock industry» for ten years before Mirando's QA crew arrives.

Even for a master cinematographer like Roger Deakins, Sicario was a tricky project to pull off — a logistical puzzle with many moving pieces, including aerial and night - vision footage and highly choreographed action sequences.

Dr Bill Mitchell, Director of Education at the British Computer Society and one of the founders of the Barefoot Computing Project, said: «A lot of people don't realise that computational thinking concepts like logic, sequencing, abstraction and debugging now underpin much of what we do in our daily lives.

The course is sequenced starting with foundational material like learner assessment and curriculum development then focuses on research - based pedagogical approaches to teaching and finishes with either a research or capstone project.

For example, C3WP's curricular materials illustrate how short instructional sequences that focus on a limited set of skills or practices can build over time and culminate in substantial projects like those undertaken by McWilliams» and Olsen's students.

You'll join acclaimed letterer and illustrator Jessica Hische as she walks through her personal lettering process and share tips and tricks from throughout her stunning career, ranging from personal projects like «Daily Drop Cap» and «Should I Work For Free» to opening title sequences for Wes Anderson.

His projects are mainly sculptures, installations and videos departing from concepts like structure, sequence and matter.

Watts is Pielke Sr's protege... I'm not sure of the sequence of events, but Watts's Surface Stations project grew out of RPSr's questioning of the quality of the surface temperature records and it's been like father and 2nd son ever since, apparently.

The combination of blockchain tech and genetic sequencing isn't exactly new, and cryptocurrency projects like genecoin have highlighted how the energy - intensive mining process (by which new transactions are added to a blockchain, with new coins being minted as a reward) can be applied for scientific purposes.