Sentences with phrase «specific reagents»

Importantly, this approach is adaptable for use in a Chemistry, Manufacture and Control drug screening protocol and may have applications in identifying lineage specific reagents, thus providing additional evidence for the utility of stem cells in screening and discovery paradigms.

Our results also suggest that such a strategy is rich in the potential of identifying lineage specific reagents and provides additional evidence for the utility of stem cells in screening and discovery paradigms.

As a reagent manufacturer, we offer a comprehensive selection of gel, capillary, and next - generation sequencing PCR assays for gene rearrangement, chromosome translocation, and gene mutation detection as analyte specific reagents (United States), research use only, or CE - marked in vitro diagnostics to laboratories (outside of North America).

We provide a full - range of standardized CE - marked in vitro diagnostic products for hematology - oncology, as well as RUO assays, analyte specific reagents (ASRs), and DNA & RNA controls.

This fluorescent marker can be turned on at any time by administering a specific reagent to the animal.

When the Novartis team used a more specific reagent to measure GDF11 levels in the blood of both rats and humans, they found that GDF11 levels actually increased with age — just as levels of myostatin do.

Not exact matches

The NLISA platform uses a process call gel electrophoresis to screen synthesized, single strands of DNA «reagents» that change their shape in the presence of a specific biomarker.

They developed the dongle to be small and light enough to fit into one hand, and to run assays on disposable plastic cassettes with pre-loaded reagents, where disease - specific zones provided an objective read - out, much like an ELISA assay.

The selective binding of specific bacterial species and / or strains in current practice requires expensive «cold - chain» reagents such as antibodies which often preclude using these processes outside of a hospital setting or in developing nations.

By using these reagents and v - abl - specific antisera, it was demonstrated that the P210 in CML cells is indeed the protein product of the 8.5 - kilobase transcript.

RNA was reverse transcribed with a PrimeScript RT reagent Kit (Takara) and quantitative RT - PCR was performed with LightCycler (Roche, Nutley, NJ) using SYBR Premix Ex TaqII (Takara) and gene - specific primers (Acks; 5 ′ - AGTGATGTCTGACCGAGCA - 3 ′ and 5 ′ - CGAACGCACTTTGGTTAGTC - 3 ′ ef - 1α; 5 ′ - TTGGTTTAAGGGATGGACTG - 3 ′ and 5 ′ - CCATACCTGGTTTCAACACA - 3 ′ [49]-RRB-.

Each assay was performed 1 - 3 times as a sandwich ELISA assay with reagents based on those of R&D Systems, Inc. (Minneapolis, MN) specific for TGF - β.

The laboratory of Vincenzo Cerundolo is the first group to report the use of tetrameric soluble class I / peptide complexes (tetramers) for the identification of tumor - specific cytotoxic T lymphocytes (CTLs), and subsequently shows that these novel reagents allow rapid and accurate analysis of human CTL responses.

This kit contains all of the reagents necessary to prepare custom gesicles to deliver Cas9 and a user - defined, gene - specific guide sequence.

I am interested in understanding how dengue virus and zika virus - specific T - cell responses can mediate protective immunity or disease pathogenesis, and in defining new protective T - cell epitopes for immunotherapeutic reagents or novel vaccine development.

Our antibody - based, target - specific protein quantitation reagents, kits, and panels for life science research, collectively called immunoassays, include matched antibody pairs, uncoated and coated - plate ELISA kits, and multiplexing assay tailored to your needs.

The user will be responsible for the timely delivery of GMP grade test substances (and reagents (e.g. specific antigens) when it applies).

HIV - 1 neutralization is impacted by the PBMC donor used for both virus growth and target cells, and the effects are neutralization reagent - specific

Each gallery contains multiple examples of gene specific in situ RNA detection achieved using one of our RNAscope ® Reagent Kits.

These reagents can be combined with coins in hero - specific recipes to unlock skill points and additional experience points for the character.

When crafting those items, a crafting reagent specific to that style is required, and is consumed when the item is created.