Sentences with phrase «standard copy of»

Prospective employers can tell when you've sent them a standard copy of a CV.

However, the bundle is also available in multiple different versions, but without the limited edition console and includes only a standard copy of the game:

The Halo Wars 2 bundle comes with a copy of the Ultimate Edition, which includes the Season Pass and early access to the game, while the Forza Horizon edition come with a standard copy of the game.

If you like your explorations in post-nuclear war Russia to be harder than hard nails, where there's no HUD and enemies are that little bit more aggressive, well, you're going to need to pony up for a pre-order of Metro: Last Light because it won't be available in a standard copy of the game.

The package also includes a standard copy of «Gears of War 3,» a wired headset, plus a download token for bonus game content including the Infected Omen Weapon Pack and the Adam Fenix character for use in multiplayer.

They have more bundles available to suit every player which all come with a standard copy of Gran Turismo Sport on Blu - ray disc *:

There is also a standalone Limited Edition DUALSHOCK 4, as well as a version that's bundled with a standard copy of the game *.

The bundle will pack in a custom - skinned PS4 Pro with a 1 TB hard drive, a limited - edition Rathalos PS4 controller, a physical standard copy of the game, and digital goodies such as a dynamic PS4 theme and items for Monster Hunter World.

Not exact matches

If your customer service personnel, especially online, have any responses in their quiver of standard answers that read like robotic, pasted copy, find them and start over.

AIDA is one of the most standard copywriting formulas for most any type of marketing copy.

In his post, Chandler accuses Arista of four sins: incorporating Cisco features that are not industry standards; marketing those features; promoting its ability to copy Cisco as a way of increasing Arista's value; and emboldening competitors to follow suit.

While some rights holders have argued that the standard for a substantial is very low (the National Post recently argued in a case that «even the reproduction of a small number of words in a newspaper article can be an impermissible reproduction»), the Copyright Board says that its preliminary view is that «copying of a few pages or a small percentage from a book that is not a collection of short works, such as poems, is not substantial.»

As long as your sales pages have the standard tracking code you obtain from Google or Facebook, and your E-junkie account is opted - in for our new cart and thank - you pages, and you're using our standard cart button codes with at least one copy of View Cart code on every sales page, our new thank - you pages will automatically insert the proper GA / FB tracking code (including Ecommerce Tracking details for GA) whenever it detects the buyer's browser has a tracking cookie set by that code.

The platform, built atop the Bitcoin blockchain, will facilitate the issuance of blockchain - based academic certificates, which will complement the hard copies that are currently standard.

Eventually, standard copy editing might be added to the list of jobs your kids won't know existed.

We do not copy other nations standard of intolerance, we set the standards of tolerance for the world.

To receive a free copy of the Chinese consumer summary report or for more information on the new Group Standard and how EXBERRY ® Colouring Foods can be used in product developments or reformulations, please contact: www.gnt-group.com.

Our Ethical Sourcing Code of Conduct is modeled after the ETI standards, a copy of which can be found under the Ethical Sourcing link at http://www.drpeppersnapplegroup.com/company/ethical-sourcing.

Non-GMO Project hereby grants you a non-exclusive, revocable license to use the Website and any materials provided via the website solely for Your own personal use, subject to and as set forth in this Agreement only upon the express condition that You accept each provision of this Agreement and provided that: (i) you will not reproduce, copy, distribute, or make derivative works of the Website, the Standard (except for the limited right to download a personal copy of the Standard), or any other materials form the Website, in any medium without Non-GMO Project's prior written consent; (ii) you will not alter or modify any part of the Website other than as may be reasonably necessary to use the Website for its intended purposes; and (iii) you will otherwise act in accordance with the terms and conditions of the Agreement and in accordance with all applicable local, state, and federal laws.

But yes, not a fan of Eberts» takes though I appreciate the occasional inside scoop type stories (when they aren't copy pasted from another outlet with poor journalism standards).

We force youngsters to copy the first team and sign players who play different styles from the first team (ridiculous) instead of us to emphasise on our principles and improve them we employed double standard now we are no where and we want to beat other teams who worked while we slept and improved while we chased money and fame?

It's not part of the standard game, which is a little annoying, but those who pre-order of buy «Day One» copies of F1 2017 will get the MP4 / 4 and it'll be available to buy at a later date.

Ripp's Friday email said he would «hold my financial disclosure hostage» because of what he said were «double standards» and the town's failure to provide him with «certified» copies of financial disclosure forms of Republican candidates and a town employee requested under the state Freedom of Information Law.

A few minutes later he inadvertently told the deputy Speaker, who scolded him for waving a copy of the Evening Standard's front page during yesterday's Budget, not to be «so silly».

In its draft report of recommendations to the governor, the Common Core task force is calling for an overhaul of the state's testing system, the creation of new state standards and transparency on those standards» rollout, according to a copy obtained by POLITICO New York.

But there is widespread concern within the industry about the quality of journalism being published online, with «clickbait» often ruling the roost and the performance of reporters being judged solely on visitor numbers as opposed to the standard of their copy.

The Committee for Taxi Safety sent letters dated Monday to Nassau County Executive Edward Mangano and Suffolk County Executive Steven Bellone to enact tougher local standards on ride - sharing companies to improve safety to passengers that are required under the state law, according to copies of the letters provided to Newsday.

But Manuel Hohmann at the University of Tartu in Estonia has been working on an alternative called multimetric gravity, which involves copies of the standard model of particle physics that each have slightly different properties.

If the conference saved 19 million sheets of standard copy paper (and from attending some past events I can vouch that not all documents are on such inexpensive paper), that might translate into saving the lives of some 2,275 trees.

Our task therefore is not to recreate a copy of the Soviet system for managing science, but to create a system for the scientific Russia today, a system of incentives and support, regulation, and legal protection for intellectual property, based on international standards.

An international team led by Ingrid Felger, from the Swiss Tropical and Public Health Institute in Basel, Switzerland, took advantage of genes that have multiple copies in the parasite genome to reveal parasites present at concentrations that are 10 times lower than the detection limit of current standard assays.

Since 1971, the standard tumor suppressor model has held that cancer is caused by a «two - hit» cascade in which first one copy and then the second copy of a gene becomes mutated.

In 1959 French pediatrician Jrome Lejeune discovered that these children have three copies of chromosome 21, instead of the standard two.

Walker said that the effect of one standard deviation increase in the overall inflammation score in mid-life on brain volume decades later was similar to the effect associated with having one copy of the apolipoprotein E (APOE) e4 gene that increases the risk of Alzheimer's disease.

Single DNA strand bearing three copies of the human Maf - recognition element (MARE) core motifs, 5 ′ - CTAGCTGCTGAGTCATGCTGAGTCATGCTGAGTCATC 3 ′, and its complementary strand, 5 ′ - TCGAGATGACTCAGCATGACTCAGCATGACTCAGCAG 3 ′, were synthesized and annealed through standard procedures.

For each assay, a standard curve was generated with known copy numbers of XMRV RNA.

Do Your Homework Get a copy of your school district's wellness policy and see whether your school is meeting its nutritional standards.

Stacked in pairs, the four discs claim opposite sides of a standard keepcase, which holds an insert with directions and a unique code for unlocking the digital copy and is topped by a gold - bordered embossed slipcover.

Correction: The limited - edition Star Wars Battlefront bundle includes the game's Deluxe Edition, while the discounted bundle comes with a digital copy of the standard edition.

Each online U.S. ticket purchase will include a standard digital copy of Dirty Computer.

The JUSTIN BIEBER: Never Say Never Blu - ray / DVD Combo with Digital Copy and standard DVD include a concert dance off that was not shown in theaters in which Bieber and his crew show off their amazing moves, a full - length concert performance of «Favorite Girl» from the Director's Fan Cut of the film, footage of Justin's team surprising lucky fans with free concert tickets and a final farewell to Bieber's signature hairstyle.

While the Standard edition will, of course, net you a copy of Halo Wars 2 to play on both PC and Xbox One through a single - use code, the Ultimate Edition grants four - day early access (Feb 17 rather than Feb 21), a season pass and a copy of Halo Wars Definitive Edition - a upgraded port of the original Halo Wars with all past DLC, extra achievements and improved visuals capable of running on both PC and Xbox One.

The four discs are packed in a wider than standard Blu - ray case, where they're joined by an insert of digital copy directions and activation code.

The two discs claim opposite sides of a standard slim eco-friendly Blu - ray case, which was without slipcover in my review copy despite what some online graphics indicated.

According to a press release, Ubisoft will offer copies of the game — Standard, Advanced, Gold, Complete Edition — at up to 50 % off.

That package still features the classic game vouchers but downgrades the copy of Battlefront to the standard edition.

The two discs claim opposite sides of a standard eco-friendly Blu - ray case, which goes without a slipcover but does provide an insert with your digital copy code and directions.

The upside of that is that the digital copy of the film (a now standard inclusion on just about every combo) is included on the same DVD as the film itself.

Nintendo officially releases these AR images as standard AR cards, but any well - done scan or copy of these AR images in any size is compatible with the app.

Checking the first copy of the Digital Cinema Package (DCP) or 35 mm print to verify that it meets suitable quality standards for duplication