Sentences with phrase «then follow the letter»

Not exact matches

We then had two follow - up letters that went out over the next few weeks, but both of those were sent by first - class mail, and we estimated it cost about $ 150 for those to be printed and delivered.

• Make sure you receive any and all payment instructions when you get an order, then follow them to the letter.

Researchers had participants stop strangers on the Stanford campus and, following a simple script, request two favors: fill out a short survey and then, regardless of how the stranger responded to that request, drop off a letter at a nearby post office.

Then after doing some research, I sent another follow - up letter kindly asking the status of the position that was still awaiting to be filled.

It's the art of writing so persuasively that the reader stays with you till the end of your article or letter and then follows your call to action (by purchasing a product, subscribing to a list etc).

Then follow up with each letter in the alphabet.

If the bible was still followed directly to the letter (which believe me, some people do) then we'd still have slavery, now....

If it came from ANY of the «letters to» then you're not following JESUS, you're following SAUL who was a GENTILE.

Reporting the following week, the Burnley Express correspondent wrote: «If there were a roll of honour whereon could be inscribed in golden letters the most meritorious deeds of any club, irrespective of whether they be in the competition embraced by Cup or League, then the performance of Burnley at White Hart Lane would be given most careful and special recognition.

The school then telephones the fathers and follows up with a letter.

They contacted me last year to ask a question about one of my patients and I told them, then sent a follow up letter telling them that I wanted ALL my charts removed from their database and the research.

Last year, at your request, we wrote to the sailors aboard the USS John F. Kennedy, and received so many wonderful letters of thanks, we followed up with Valentines, then Easter cards.

The general drift of his letter shows that he thinks a Conservative government would renegotiate our relationship with the European Union, but then he writes the following:

«If what you really want — and I believe that it is — is the truth, then you must draw the terms of reference such that the police inquiry has licence to follow any lead it finds in what will be, after all, a serious criminal investigation,» he said in a letter to the prime minster.

She said the refugee status followed a request by National Security to the then - Chairman of the Ghana Refugee Board and a letter was issued to that effect on 21st July 2016.

He denied the allegations in a conference call with reporters, then followed that up with a public letter from several women who used to work for him attesting to his virtues, and characterizing the alleged misconduct as «completely out of step with the man we have worked closely with.»

For each condition, 200 ng genomic DNA was then PCR amplified using Platinum Taq High Fidelity (Invitrogen) using the following primers plus 454 adaptor sequences and 8 letter DNA barcodes: CAACCTCTACAGCAGTGTCCTCATC (forward) and GGAGTGTGACAGCTTGGAGATG (reverse).

Yes, I will personally guarantee that if you follow my Psoriasis Program to the letter then you will have got rid of your psoriasis permanently.

All you need to do is follow the program to the letter for 90 days... then sit back and smile while you watch the new muscle start piling on.

Singapore's internet regulator will block access to infidelity website AshleyMadison.com following a public... then it would not protect public morality,» said a letter to a newspaper forum.

The system of payment for opening letters is the following: men should first purchase credits (as low as $ 1 per credit) and then apply credits to each opened letter.The number of credits needed to open each letter varies.

Then follow the link in the confirmation letter you receive by e-mail to finish the process of account creation.

Then he extends that notion of how meaning and emotion can be conveyed representationally, by having Jones follow the saga of some hatchlings at his mum's house via letters that the audience has to read; and by lovingly photographing the contours of the vegetables that stand in for women's hacked - up bodies in Jones» foley process.

«OK, I'll follow the government lessons to the letter,» they reason; «then nobody can blame me if my kids don't get their Level 4.»

Students identify the pattern used, predict the next picture in the pattern using the pictures cards, and then match the picture strip with the letter cards that follows the same pattern.

For each sound, blend, diagraph or dipthong there are 3 or 4 pages: Add the blend or diagraph to the word and connect to the matching picture Clear clip - art (black and white - perfect for colouring) labeling page using 9 carefully chosen example words / clip - art followed by a fun read and draw page then a cloze page of decoadable sentences which have been carefully sequenced to progressively incorporate words that are consistent with the letters and corresponding phonemes that have been taught to the new reader / speller in previous pages of the book (plus sight words) Could be made into a 168 page workbook, or of course individual pages can be printed off and photocopied.

But if the secretary follows the spirit and letter of the law, then state and local school leaders will finally be able to run their schools the way they believe is best, without worrying about the federal government getting in the way.

I was lucky enough to have the following items for the evidence: Bloody dagger Vial Soap And then the rest (evidence sheet attached) was printed (I tea stained and burnt the letter and diary entry).

This followed a joint letter to the then Secretary of State, Justine Greening, in November 2017 which similarly set out our concerns and our proposed solutions.

A follow - up letter over the weekend then stated that «all items have been remedied to our satisfaction» and that school leadership has agreed to postpone the material revision vote until November, when «we expect to receive approval from LAUSD for our TK - 8 merger.»

Other states would follow the letter of the law, but not the spirit, shutting down schools in black neighborhoods instead of providing what was then considered to be high - quality education.

The follow letter reiterates why he earned that title and why Connecticut's Governor, Education Commissioner, State Board of Education, State Legislators and State Representatives would do well to read the letter, read it again, and then act to save Connecticut's public schools before it is too late.

So, what are districts to do when they are to follow the letter of the law, and the accountability policies being financially incentivized by the feds, and then the states (e.g., via Race to the Top and the NCLB waivers)?

In a series of crimes that has stunned Washington, D.C., bank robbers have been laying out precise demands when they enter the building - and then killing the bank employees and their families if those instructions are not followed to the letter.

One then finds the junction between the message's letter and the key phrase's letter on the Square (the message's letter on the left - hand side and the key phrase's letter on the top), and records the letter at their junction, as follows: Message: h o w, i s, t o n i g h t, d i f f e r e n t, f r o m, a l l, o t h e r, n i g h t s Key: c o m, e r, e t r i b u t, i o n c o m e r e, t r i b, u t i, o n c o m, e r e t r i Cipher: j c i, m i, x h e q h b m, l w s h s d i e x, y i w n, u e t, c g j s d, r z k a k a Deciphering the message entailed reversing the process by finding the cipher letter on the left - hand side of the Square and the key - phrase letter on the top side of the Square, and recording the letter at their junction.

When you have done all the right things, get good critiques, follow submission directions to the letter, write the best story you know how and then some, revise revise revise and still are not published, and this goes one for years and years, self - publishing must start looking pretty good.

Delete: If you don't follow submission guidelines; if you attach information instead of pasting it into the email; if the query letter is long, rambling, incoherent; if you're querying a genre I don't represent; if you spend paragraphs tooting your own horn and then the writing is atrocious; an incomplete manuscript; work that isn't fully edited and polished.

Of course not, but the chances are, if you keep following the steps and persevere with sending out query letters, making connections and improving your writing style, then I would be surprised if you have not had a book or three published.

You will need to wait for a letter in writing from the IRS and then follow the steps outlined.

Anyone who's followed the strategy of putting 90 % of their money in stocks and 10 % in bonds that Warren Buffett mentioned in his 2013 letter to Berkshire Hathaway shareholders — and then later expounded on as part of a 3 % to 4 % annual retirement withdrawal system in a TV interview — would have done very well in recent years.

If creditors do not follow these stated polices, then their calls and letters could be labeled as harassment.

Their in - house collection procedures go about as far as a few series of letters and phone calls followed up by a few threats, then they turn the account over to a collection agency.

While at other times, we will send this letter and then follow - up with a phone call to confirm they received it and proceed with debt negotiations.

Then follow - up with a written dispute letter pointing out the errors in the report.

These letters are then followed by a number — 1 through 9.

If you want to adopt this more militant approach (we're not specifically advocating it, but as it's worked for some, we are giving it as an option) then the following template letter should help, though if your lender refuses you may then need to threaten small claims court action.

If I don't contact the lender and work out some kind of solution, and instead choose to ignore the problem, then I'll probably get a follow - up letter within a few weeks.

If the account appears open, repeat the process: Call the customer service number to report the mistake, follow up with a letter by certified mail (including a copy of your original letter requesting that the account be closed) and then check your credit report again.

Make and post flyers, call friends, write letters to newspapers, post bulletins on MySpace, contact the media by sending a press release and then following up with a phone call.

If, despite our request that you not send us your ideas, you still choose to submit them to Koch Media, then regardless of what your letter says, the following terms shall apply.