"Total length" refers to the complete measurement from one end to the other end of something. It simply indicates the entire or full extent of an object or distance.
Full definition
In our breed, it is about two inches
in total length with an upper diameter similar to that of a pencil.
Such was the case with this dress which ended up fitting nicely off - the - rack, with the waistline and
total length even hitting near my ideal spots.
Don't buy a 1940s / 50s dress that's shorter than 42 inches
in total length (for me, 44 at least).
Google's own Nexus devices (and now Pixels) have always been the undisputed champion of Android updates — at least, in terms of
total length of support.
Package, cruise, tour, rail & hotel prices are per person, based on double occupancy
for total length of stay unless otherwise stated.
To shorten the overhangs of the new car, BMW has increased the wheelbase by 3.2 inches while only stretching
total length by 1.9 inches.
A classic piece Size M With drapes at the front Great condition 96 % Viscose 4 % Elastane Chest; 47 cm Waist: 40
cm Total Length: 91 cm
Total length now comes to 16.2 feet, an increase of 7 mm compared to the outgoing model.
That should be enough to provide sprightly performance, despite the car's 3 tonne - plus weight and 5.34
m total length.
Chanel Chain Link Pearl Long Drop Drape Evening Necklace Metal Faux Pearl Gold tone hardware Lobster closure Made in
France Total length 34»
Description This is one of the largest species of the genus and reaches nearly 70 mm in snout vent length (up to 130
mm total length).
Now, Thomas Hales of the University of Michigan, Ann Arbor, has shown that a hexagonal honeycomb has walls with the
shortest total length, per unit area, of any design that divides a plane into equal - sized cells.
Video (4) Cute Free shipping Type: Socks Group: Adult Gender: For Women Style: Fashion Pattern Type: Animal Length (CM): Foot Length: 22 -
25CM Total Length : 38 - 41CM
John Galliano's classic and elegant high - waisted medium - weight lavender wool crepe combined with 3 % spandex for that perfect fit where needed measures 41 1/2» in
total length on...
The video is quick to point out the Nurburging's 154 turns and 12.93 -
mile total length, a distinction that earns the track the nickname, «The Green Hell.»
Priced from USD $ 189,350, this exceptional addition to the product lineup offers more than 8 inches in
total length when compared to the standard S - Class and features a suite of intelligent safety technologies and exclusive appointments that complete the opulent package.
Item measures 17 1/2 inches armpit to armpit and is 38 inches in
total length down center back.
The
maximum total length of the shoulder strap is about 120 cm and the minimum length is about 44 cm.
O'Shea estimates that a colossal squid's mantle could grow up to 4 meters long, with a
possible total length of 12 meters.
«Our hypothesis was that
if total length and travel distance were important evolutionary criteria for plants, there would be evolutionary pressure to minimize the criteria together, and that's actually what we found,» says Ullas Pedmale, who was a postdoctoral researcher on the project and is now an assistant professor at Cold Spring Harbor Laboratory.
A PCR product from nucleotide 4,178 of F09D5 (primer UNC - 9A: 5» - TCAGACGCGATGTTTTGTAGGTGGG - 3») to nucleotide 9,849 of cosmid R12H7 (Primer UNC - 9B: 5» - CCACTTGATGTTTCACGTGTAGCGC - 3») was amplified (Expand Long Template PCR System, Roche Diagnostics, Indianapolis, IN, USA) from genomic DNA (14,678
nucleotides total length).
Fantastic jacket by Isabel Marant Alpaca wool Grey color Embroideres sequins Single button 2
Pockets Total length from shoulder cm 70 (27.5 inches) Total weight 1.9 kgs / 4.1 pounds Worldwide express shipping included in the price!
Flat Measurements Not Worn:
Total Length 72cm / 28.5», Bust 45cm / 17.5», Sleeve Length 27cm / 10.5».
95 % Viscose 5 % Elastane.Flat Measurements Not Worn:
Total Length 62cm / 24.5 «Sleeve Length 35cm / 14».
Bust: 34 and can stretch up to 38 Waist: 29 and can stretch up to 32 Underarm - to - waist: 7.5 Hip:
free Total Length to hem: 41.5
Total length not including the shoulder straps is 36 ″, width across the banded area is 13 ″, and skirt lining is 16.5 ″ across at the hips.
Composer: Joseph Bishara Audio CD Release Date: September 24, 2013) Number of Discs: 1 Label: Void
Recordings Total Length: 43 minutes
«Les Misérables» Highlights From The Motion Picture Soundtrack Release Date: December 21, 2012 Label:
Universal Total Length: 1:05:22
If the employer wants you to know all Microsoft Office programs, with a special focus on Excel, and you've worked with it for five years, note that in your cover
letter.The total length of your document should not exceed a page and typically should be a lot shorter than that.
Compared to the existing version, the mass of the new system has been reduced by 7 kg (15.4 lbs) and
total length by 24 millimeters (0.9 inces).
Your little miracle's
total length from the top of the head to the tip of the toes is about 19 1/2 - 21 inches now and he or she weighs approximately 6 1/2 pounds or more.
Chanel Silver Charm Chain Blue Long Drape Drop Evening Drape Necklace in Box Metal Bead Silver tone hardware Made in
France Total length 38.5» Includes original Chanel box
This is one of the largest species of the genus and reaches nearly 70 mm in snout vent length (up to 130
mm total length).
num num sharkies eating my feet Free shipping Type: Socks Group: Adult Gender: For Women Style: Fashion Pattern Type: Animal Length (CM): Foot Length: 22 -
25CM Total Length : 38 - 41CM
The standard Titan is nipped and tucked compared to its bigger brother with a 14 - inch difference in
total length when comparing crew cab and standard bed examples.
The RadWagon, which the company describes as the «ultimate electric cargo bike,» is not your brother's cargo bike, in the sense that it's not a full - on conventional cargo bike that could pull double - duty hauling massive amounts of materials, but is instead not much bigger than a standard bicycle (80» / 203
cm total length).
SH 130 is 91 miles
in total length extending further south and west to I - 10.
Breitschwerdt likes to boast about the small car's sophisticated design, noting, for example, the car's inside space occupies 70 % of
its total length.
Phrases with «total length»