Sentences with word «unc»

To verify an AVB but not motor neuron requirement for UNC - 7S, UNC - 7S:: GFP under control of the sra - 11 promoter [31] was expressed in unc - 7 (e5).

Phenotypic rescue of unc - 7 by various constructs was assessed by tapping transformed animals on the nose or tail and observing whether or not smooth sinusoidal waves were propagated.

This construct (plus F56B12) fully rescued unc - 7 (e5), suggesting that either UNC - 7L can rescue locomotion, or UNC - 7SR is produced through internal translation initiating at M121.

Eight animals displayed a severe backward Unc phenotype but were still capable of forward locomotion, confirming that AVAs had been properly ablated.

This construct included a frame - shift mutation within the unique amino terminus of UNC - 7L that eliminated its production, indicating that UNC - 7S alone is sufficient for unc - 7 function.

Unc Charlotte.

Neurons expressing unc - 7:: gfp include members of all motor neuron classes (AS9 - 11, DD5, VD10 - 11, VA10 - 11, VB11, DB7, and DA7).

A: Myself and several others from Penn Medicine have been serving as UNCs for about five years.

Such animals were expected to be non-Rubberband because mnDp3 complements the sup - 10 mutation in the body wall muscles, dye - filling defective because of the ABp focus of daf - 6, and to give rise to both wild - type and Unc Rubberband progeny because of maintenance of mnDp3 in the germline derived from P1 descendants.

We are using unc - 7 as a means to understand how electrical synapses are specifically established between cell partners.

the winning unc alpha challenge Team: congrats to csima members kevin Lin, damian creber and ed reynolds for taking home first prize with their cardtronics short and mrc global long PITCH

the winning unc alpha challenge Team: congrats to csima members kevin Lin, damian creber and ed reynolds for taking home first prize with their cardtronics short and mrc global long PITCH

There is no way we lose to Wisconsin, so Carolina, Gonzaga or unc if Omari was playing for us last year.

(E) unc -7-2cDNA6 with exons 2 — 6 replaced by corresponding cDNA sequence, shares 1 kb of intron 1 overlap with F56B12.

Previously we showed that the innexin unc - 7 gene is essential for coordinated locomotion in C. elegans [9].

UNCs stand on catty - corner 25 - yard lines during NFL games, watching for possible concussions and assisting team physicians in evaluating players.

The Caenorhabditis elegans unc - 103 gene encodes a potassium channel whose sequence is most similar to the ether - a-go-go related gene (erg) type of K + channels.

One rescued line, EH536, was maintained and used for genetic crosses involving unc - 9 (fc16).

Ectopic unc - 7 (e5) AVA: B motor neuron gap junctions are indicated (red dashed line).

Five of the latter were classified as exhibiting a weaker Unc - 9 phenotype.

Broods from these animals grown at 15 °C were later examined for the presence of any animals displaying a kinker (Unc -124-like) phenotype.

Long - range unc - 9Δ:: gfp PCR products for micro-injections were similarly PCR - amplified from ligations using the UNC - 9A primer plus a primer specific to pPD95.77 (5» - TTGCTACAGGCATCGTGGTGTCACG - 3»).

Like unc - 7S:: gfp, this construct rescued forward locomotion in the absence of cosmid F56B12, and we postulated that M121 in exon IV (the canonical innexin start site) might be used to generate a shorter but functional UNC - 7S - like product (UNC - 7SR).

Forward and backward movement are both affected, but the forward Unc phenotype is more severe.

Anonymous sex sex your area Wilde - m4m 33 hide this post Oct 3 Bi unc at the.

Synopsis: Col. Claus von Stauffenberg (Tom Cruise) serves Germany with loyalty and pride but fears that Hitler will destroy his country if allowed to run unc... [MORE]

Everyone occasionally experiences normal jealousy; caring about anyone or anything means that one will become unc...

We carried out a non-complementation screen for new alleles of unc - 124 and identified four new mutations.

we did not discover information about Pet stores in Kannapolis, Unc Charlotte and Providence, but select Pet stores in North Carolina such as Country Tack & Outfitters, placed in

(B) Fully rescuing unc - 7 min plasmid expressing UNC - 7S and UNC - 7SR.

Is this reboot what fans deserve after being disappointed by Spider - Man 3 or should the series be as dead as Unc... Read On

Using unc - 9 mutants and heterologous promoters, we showed that expression of UNC - 9 in B class motor neurons is necessary to rescue the localization of UNC - 7S expressed in AVB.

Unc - ch will just claim that it's not just athletes who rape and Bilas will boldly point out that is true.

As others have said, this state is a bad joke and the media and institutional powers can not be trusted when it comes to UnC - Ch or NC State.

On the other hand it feels like even at 21 wins, with a (9 - 9) record we could still be on the outside looking in if we can't pick up any really big road wins and also fail to pick up a ranked win, say if louiville, uva, duke, unc, and clemson are the losses.

Get ideas from other parents for changing diapers with an unc...

So had his coinvestigator, Niels Lindquist, a unc marine scientist.

The referees can only see so much on the field, so it's great that we have spotters watching from the booths, and slow motion replays and UNCs to catch anything the refs might miss.