If you worry about spreading the virus to someone else, you may choose to have sex with people
under the same condition.
You see, more than 95percent of managers can not achieve this fit
under same condition, therefore I concur with you that it is a miracle.
In Trump's West Wing, once the rumors begin that an aide's exit is forthcoming, the «stink» on that staffer never leaves, according to one of the nearly dozen White House aides, former administration officials and outside advisers who spoke to The Associated Press
under the same conditions.
«Then you need to look at the individual and understand why they are not performing if everyone else is
under the same conditions.»
«We can not declare genocide for Yazidis and not Christians if they are suffering the safe fate at the hands of the same perpetrators at the same time
under the same conditions.»
Naturally, the workers hired first grumbled, and we would stress the naturally; there never was a group of workmen who would not have grumbled
under the same conditions.
A partner in a civil union can inherit
under the same conditions as a spouse in a married couple, but his partner must have drawn up a will and designated him as the heir.
If the therapist were to experience these feelings
under the same conditions of worth that the client attaches to them, he would become alarmed and attempt to fend off the same feelings the client was trying to avoid.12 He must show the client how to accept the full range of his experiencing, and thereby overcome the inner division within his soul.
When grown
under the same conditions as comparable high - yielding inbred rice varieties, commercial hybrid rice can generate up to 30 % higher yields.
Our success in those games when other teams are awful
under the same conditions show that is part of the plan.
Millwall had to suffer a torrid time on what was described as a beach by various pundits, and Spurs boss Mauricio Pochettino was not happy with the prospect of his team playing
under the same conditions.
Each team creates a healthy, delicious school lunch — a protein dish, a vegetable side and a fruit side — that adheres to strict nutritional guidelines and is prepared
under the same conditions faced by school food service programs.
With access to more natural light, the makeup you apply can be better matched to your complexion
under the same conditions as the outside environment.
It was pumped
under the same conditions (ie, milk bank - approved medical conditions) as when you became qualified.
Make sure that you are comparing weights on the same scale, and
under the same conditions - time of day, if they just ate, have a wet diaper or clothes on can make a big difference in those early days!
When you move to another EU country you can get healthcare
under the same conditions as other local residents.
Education stakeholder groups warned that creating a new evaluation system
under the same conditions as the last one likely won't lead to better results.
At right, a new kind of ceramic is barely visible
under the same conditions, so interferes less with the analysis.
In comparison, PNNL's previous tag only lasted 23 days
under the same conditions.
«Different alternatives need to be evaluated side by side
under the same conditions using objective measurement instruments.
These changes in gene regulation differed from those of mice or rats
under the same conditions, the researchers found.
To be able to experimentally verify this «and» state and its unique quantum mechanical properties, the team had to create a large number of these atomic systems
under the same conditions and with different settings of the lab setup.
A variety of different conformations were observed, and as de Gennes notes, two chains can exhibit very different behavior even when put
under the same conditions of stretching.
What de Bivort found when he first used it surprised him: The animals» behavior varied much more than he expected, even when the flies were more or less genetically identical and raised
under the same conditions.
«These reactions are exceptionally productive, especially if you compare them to analogous reactions with existing RNA components, which do not produce any nucleotides
under the same conditions,» Hud said.
In comparison, the commercial enzyme mixture produced 10 per cent less glucose
under the same conditions.
By simulating past summers — instead of relying solely on observations — the scientists established a large range of temperatures that could have occurred naturally
under the same conditions, including greenhouse gas concentrations and volcanic eruptions.
In August 2013, the Organization for Economic Cooperation and Development issued an analysis of economic damage incurred among the world's largest 136 coastal cities and the damage they will sustain by 2050
under the same conditions.
That suggests that when fed the same diet and housed
under the same conditions, darker birds remove more zinc — and possibly other noxious heavy metals — from their bloodstream than light - colored birds do.
The detailed process will also give forensic scientists valuable insight into how seawater affects deceased bodies, as they examine people of all ages and nationalities who died at the exact same moment
under the same conditions.
They use the extracted DNA as a template in 2 separate PCR reactions run
under the same conditions.
Isotype control antibody (black line) was rabbit IgG (monoclonal)(1μg / 1x106 cells) used
under the same conditions.
Only a small subpopulation of cells are capable of picking up DNA, a state known as «competence,» at any given time, even when the cells are genetically identical and grown
under the same conditions.
Isotype control antibody (black line) was mouse IgG1 [ICIGG1](ab91353, 2µg / 1x106 cells) used
under the same conditions.
For instance, cells from line 11.1 could be efficiently induced to form contractile cardiomyocytes, while iPS cells from line 4.1 failed to do so
under the same conditions.
SETD8 (250 nM) was assayed
under the same conditions; however the Thioglo - 1 was added at the end of the reaction for quantification.
(D) Sections of EBs grown
under the same conditions as in part (C), showing that the outer layer consists of visceral endoderm as marked by Gata6, FoxA2, and Sox17 immunostaining (shown as red).
Nested PCR was performed
under the same conditions for 45 amplification cycles with 5 µl of the first round PCR product and two different primer pairs, Gag - I - F (5 ′ - TCTCGAGATCATGGGACAGA - 3 ′) and Gag - I - R (5 ′ - AGAGGGTAAGGGCAGGGTAA - 3 ′) or NP116 (5 ′ - CATGGGACAGACCGTAACTACC - 3 ′) and NP117 (5 ′ - GCAGATCGGGACGGAGGTTG - 3 ′), respectively, both of which have been shown to detect both XMRV and MLV gag sequences [13].
Even if your scale is off by 5 pounds, or your body fat caliper is inaccurate by 1 %, as long as you use the same device and measure in the same way
under the same conditions, you can track trends and paint the picture of your health and whether or not it's improving!
The longer you've trained, the harder it becomes to gain muscle
under the same conditions you're used to applying — body part specialization programs create an «emergency response» of your entire body's resources to promote recovery and growth when it's under abnormal attack.
In a recent study subjects who made the physical action of smiling — even though it was just from holding a pencil in their mouths without any emotional content — reported feeling happier than those who didn't make this facial gesture
under the same conditions.
The project was a labour of love for Zanuck and Ford in a film whose socialist politics and subtle sentimentality polarized American audiences after years of suffering
under the same conditions.
Without flagging, an admissions officer has no way of knowing whether the SAT scores of two candidates can be compared with one another, since there is no way of knowing whether the two candidates took the test
under the same conditions.
At Locke, Green Dot took the risk of operating
under the same conditions that hobble many public schools — accepting all the students within the attendance boundaries, whether or not they wanted a charter school, would follow its rules or even understood what the change was about.
This would make the diagnostic test inconclusive because it would not have been carried out
under the same conditions.
The spark you will see in a spark tester won't be
under the same conditions as inside the cylinder, so you wouldn't expect to see the same thing.
Up in Quebec, GT Radial had us drive front - wheel - drive cars shod with IcePro tires through a short slalom course on an indoor hockey rink, back - to - back with Firestone WinterForce tires
under the same conditions.
Testers will compare each vehicle in its class, back - to - back, on the same roads and
under the same conditions to ensure objective evaluation.
(The Evo 4G,
under the same conditions, is $ 200.)
All of these temperatures are well below what we consider to be too warm (95 degrees), as well as the original Helix, which hit 102 degrees
under the same conditions.