Sentences with phrase «untranslated mrnas»

Sequence variation in the 3 ′ - untranslated region of the dopamine transporter gene and attention - deficit / hyperactivity disorder (ADHD)

In the 3» untranslated region of the DRD2 polymorphism is the site of TaqIA, which was genotyped as a single nucleotide polymorphism (SNP).

To this end I hope to get translated an untranslated from Latin / French diary of conditions from 1350 to 1450.

Influence of Lanthanum on Phosphorus Uptake and Its Chemical Fractions in Rice Crop (Oryza Sativa)[translated abstract] Xie Zubin, et al [A Chinese periodical, the name of which is untranslated](2003) http://scholar.ilib.cn/Abstract.aspx?A=zgxtxb-e200302021

Subtitles appear; the words they communicate are full of philosophical longing, but they do not always synch up with an audible voice, and portions of the woman's speech go untranslated.

Hebdomeros is accompanied by an appendix of previously untranslated or uncollected writings, including M. Dudron's Adventure, a second, fragmentary novel translated by John Ashbery.

Fortunately, I didn't spot any spelling errors this time around — one of my pet peeves with previous games in the series — but did notice a sentence too long for a text box and even came across a menu that went entirely untranslated:

Turns out there's still a smidgen of untranslated Japanese text during a boss battle near the end of the game.

I'm a super fan of Yakuza as well, even if you bring Yakuza 3 untranslated, my english is nice, and japanese dub is better:), liked the way Shenmue 2 and Yakuza 2 were released in europe.

We've seen a handful of them get localized, but most stay in Japan, untranslated.

And unless there's something floating around the internet untranslated, I haven't heard a peep from any other Japanese publishers about the device either.

The demo we played was still untranslated from Japanese, so we have absolutely no idea what was happening during dialogue and cutscenes.

The only person to speak in full, clear sentences is the narrator; everyone else speaks in either bits of untranslated French, German, or, if you're playing as Freddie the American, grunts.

As an unfortunate bug that was experienced with our version before the latest patch, we experienced the inability to specialise our characters based upon what we wanted them to be, but also an issue that left much our title untranslated.

But if we want 1 book from the current campaign, and 1 book from the previous campaign or one of the untranslated book, its 50 $?

Returning to the Nintendo DS, the game (given the yet untranslated subtitle Ikai no Kyojuu) will play out much like Diablo, a -LSB-...]

Around 300 Famicom and 800 SFC games are still untranslated.

The prequel novel, Final Fantasy XIII Episode Zero: Promise, has been previously unavailable (and untranslated) in the West.

Strania is an odd title, developed by Japanese group G.Rev, it has very little in terms of English translation, to the point where there is no English logo, and the majority of «score» pickup notifications are untranslated.

There may be some other hitherto untranslated interviews in there for this or the other SuFamiMini games.

And do I need to see it untranslated every single time?

This one again breaks new ground: It will bring a previously untranslated manga by Osamu Tezuka into print in English for the first time.

CBR News: Delcourt started publishing untranslated French comics on comiXology in 2013.

But untranslated books are a real crime against culture and literature and every author should expect to get their work translated into several languages.

But I hope some of their problems (lack of information, untranslated parts) are just launch issues and not long - term problems.

The story takes place in a town in Japan and all the humans speak untranslated Japanese, except for some public occasions where there is a simultaneous translator.

Chilean - born Ruiz is a director whose love of storytelling and narrative play is often more engaging than the films themselves but with Mysteries of Lisbon, an epic based on a classic Portuguese novel (one yet untranslated into English), his engagement with the characters and their defining stories guides his direction, and his graceful camerawork and unerring eye for images both classical (like paintings in a cinematic frame) and fluid (his camera moves with purpose and grace) are in the service of the trajectories of the characters.

Source: got my casual gamer girlfriend into MH, with untranslated MHPortable 3rd no less.

Most of the Japanese dialogue is untranslated, except by an occasional announcer (Frances McDormand), and the design is heavily influenced by Asian styles.

But Anderson's choice to have the dogs, played by American actors, speaking English while the Japanese - speaking human characters are frequently untranslated feels awkward and isolating.

You could say the film is doubly obscure: adapted from a Polish novel that remains untranslated in the West, and only seen in Poland, France and Latin America.

The most interesting and informative of the new material is the documentary «The Road To The Grandmaster», which is sadly only available in untranslated Cantonese.

Or as some note in untranslated Spanish, «La vida no vale nada» («Life isn't worth anything»).

Though a decent amount of alien dialogue goes untranslated onscreen, Disney adds Portuguese to its three standard language offerings for subtitles and dubs of everything else.

Though its pitch - perfect premiere predates the aughts, Aaron Sorkin's sweeping political drama delivered some of its best punches in its following years, including an untranslated monologue in Latin.

Oh, yes, the Japanese voices are untranslated to add more authenticity or confusion as the case may be.

There's a lot of Japanese in «Isle of Dogs,» most of it untranslated by subtitles.

Leaving non-English dialogue untranslated has long been a way to «Other» certain characters and cultures, damning them to irrelevance or impenetrability.

They are recruited to an RNA - induced silencing complex (RISC) and bind to the seed sequence within the 3 ′ untranslated region (UTR) of target mRNAs, leading to destabilization and / or translational suppression of the target mRNAs (Bartel, 2009).

The resultant plasmid therefore includes the cDNA sequence for the coding region of UNC - 7S plus native 3» untranslated region sequences.

Genetic rescue via GAL4 / UAS - DTH was also successful, although this required the generation of a new UAS - DTH1 transgene devoid of most untranslated regions, since existing UAS - DTH transgenes express in the brain without a Gal4 driver via endogenous regulatory elements.

The algorithms place a lot of emphasis on target mRNAs that contain an exact 7 or 8 nucleotide match in their 3» untranslated region (UTR) to residues 2 — 8 of the miRNA, called the «seed» region.

TIA - 1 and TIAR are related proteins that bind to an AU - rich element (ARE) in the 3» untranslated region of tumor necrosis factor alpha (TNF - alpha) transcripts.

The downstream sequences were PCR - amplified using a primer with an introduced Spe I site corresponding to the start of the 3» untranslated region at nucleotide 11,704 (UNC - 9C: 5» - TTACTAGTTGACACACCCCAACTTCGTAGC), and a primer at nucleotides 12,836 — 12,860 (UNC - 9D: 5» - CTAGTCTTTGCAGAGCAAGTGAGG - 3»).

More than half of mammalian genes generate multiple messenger RNA isoforms that differ in their 3 ′ untranslated regions (3 ′ UTRs) and therefore in regulatory sequences, often associated with cell proliferation and cancer; however, the mechanisms coordinating alternative 3 ′ - UTR processing for specific mRNA populations remain poorly defined.

PTC's GEMS technology exploits the regulatory mechanisms found in the untranslated regions of messenger RNA for the identification of small - molecule drugs that can treat diseases by selectively increasing or decreasing the expression of key proteins by modulating post-transcriptional mechanisms.

An AU - rich element in the 3 ′ untranslated region of the spinach chloroplast petD gene participates in sequence - specific RNA - protein complex formation

The Spinach Chloroplast Endoribonuclease CSP41 Cleaves the 3 ′ - Untranslated Region of petD mRNA Primarily within Its Terminal Stem - Loop Structure

The sequence and structure of the 3 «- untranslated regions of chloroplast transcripts are important determinants of mRNA accumulation and stability

These mRNAs, which contain inverted repeats of the short interspersed nuclear element Alu in their 3» untranslated regions (IRAlus), are retained in nuclear bodies known as paraspeckles.