Sentences with phrase «use of templates in»

The use of templates in creating a finance resume will allow you to focus on the requirements of the specific areas where finance processes are involved, including banking, accounting, and insurance.

This webinar would interest you as a senior executive in charge of implementing training in an organization and would like to explore how a rapid authoring tool can be used, for online training; Or if you are a learning design professional, trying to understand the effective use of templates in eLearning authoring tools.

Not exact matches

Using a centralized authentication model, a user logs in with a PIN, password or biometric template that is matched against a library of all users» information.

In terms of lessons learned, Jerry Masino suggests using your franchisor's template and training, understanding customer service — «it's the cornerstone of a lot of businesses» — and making sure your location is right by hiring a corporate realtor to provided the demographics needed.

The architecture of clothing is similar to the infrastructure of a business, and technology - focused businesses in particular: Template it once, use it often, and tailor as needed.

In our content blueprint, we have a range of templates that make scaling your content really easy and provided an easy - to - use, ready - made editorial checklist.

Utilizing the HubSpot CRM & Sidekick we've created high - impact templates that allow reps to send strong emails in less time, while also allowing us to track the effectiveness of the emails and messages to use to adjust and improve the impact of the message.

Can you provide an example of an editorial calendar using the template above that has a few lines of information filled in?

In Jill and Josh's case, the Lead Magnet is a collection of email templates that they use in all their sales funnelIn Jill and Josh's case, the Lead Magnet is a collection of email templates that they use in all their sales funnelin all their sales funnels.

From those sources, we developed a set of standard templates for use under Canadian law; they largely reflect the «vanilla - preferred» terms being employed by early - stage incubators and investors in the US.

Because of the rapid evolution of legislation, I strongly suggest you seek the proper legal advice, rather than using a pre-made template that is readily found on the Internet or in books.

Authorship of John — many if not most NT scholars believe that John nor one of 12 wrote John; James — most agree not authored by James, and sometime in 2nd century AD; Peter — a mystery — some think that it could have been an early template for the other gospels; Luke — a mystery; Mark — finally it seems like we really might have another original author here — or were he and later Paul just using a very early Peter story?

no apparent evidence of ill - will, and 3)... an experience of unity.Now, David, I haven't known you for very long (blogwise), but I respect what I have read from yr deep and thoughtful spirit, so with that in mind, I just don't see how this personal experience is translatable or cd be used as some kind of template when faced with the real Wal - Mart world.Do we not, like Jesus, show out true colours under pressure.Maybe I'm missing something... please correct me If I am and remember, I'm not into boob jobs (cleavage enhancement)

While I definitely agree that his response is great in many circumstances and (without knowing the context of that conversation) may have been the perfect thing to say at that moment, I think calling this statement «a template that can be used to respond to questions concerning sexuality, gender and other important issues» reduces a very complex issue down to a very simple response that doesn't really answer any questions for anyone.

It was in some such way as this that the Christians of the first centuries, whom we call catholic, used Israel's story as a template for their own existence.

Finally, microspheres can create polypeptides using polynucleotides as templates in a reverse of the process that formed the polynucleotides in the first place.

The toolkit contains a number of templates and other tools which governments can use as a basis in their drafting process.

This model incorporates anticipatory / feedforward as well as feedback components, using an expectation of exercise duration to set an initial work rate and to generate what has been termed a subconscious «template» for the rate of increase in the RPE.

Use the template to make hearts in a variety of colors.

white card board, we used A5 piece of paper in the same size as your card board stencil, template or drawing skills pencil scissors washi tape (a selection) glue felt - tip

For the stars: I cut out a template for the stars from a square piece of black construction paper using the tutorial in this video.

You can make smaller variations of this sunflower craft by using egg cartons and yellow paper (Optional: there is a flower petal template in the Yellow Bee Free Printable).

In conjunction with the petition, the RCVS has also produced a template letter which the profession and public can use to write to their local Member of Parliament asking them to support the campaign.

In his email, Becker helpfully provided a template for his backers to use in hopes of spurring others to match their contributionIn his email, Becker helpfully provided a template for his backers to use in hopes of spurring others to match their contributionin hopes of spurring others to match their contributions.

«It is clear that the Act does not contemplate criminal trial so the usage of Criminal Procedure Act and the Criminal Procedure Code should not be used as a procedural template in the Tribunal.

Whereas there are many difficulties in the synthesis of graphene, the team of researchers at Ulsan National Institute of Science and Technology (UNIST) and Pohang University of Science and Technology in South Korea synthesized nitrogenated 2D crystals using a simple chemical reaction in liquid phase without using a template.

To create a new dengue virus vaccine, Stefan Metz, Shaomin Tian in the laboratories of Aravinda de Silva, Chris Luft and Joe DeSimone at the University of Carolina, Chapel Hill, USA designed nanoparticles of various shapes and sizes using Particle Replication in Non-wetting Template (PRINT) technology.

But pretty soon he is detailing its failings: we are overconfident in our mind - reading abilities; we use our own mind as a template for others, yet confabulate wildly to make sense of ourselves; by stereotyping people we overemphasise differences; we are woefully poor at reading body language; and we constantly misapply our mind - reading talents, dehumanising others while imbuing inanimate objects with human traits.

«This study is remarkably comprehensive, which will help any molecular laboratory design and implement their own next - generation sequencing lymphoma panel using this work as a template,» commented Robert S. Ohgami, MD, PhD, Assistant Professor of Pathology at the Stanford University Medical Center, in an accompanying editorial.

To aid in the organization of Supplementary Materials, we recommend using or following the Microsoft Word template supplied here.

Because earthlings still know of just one living world — our own — it makes some sense to use Earth as a template in the search for life elsewhere, such as in the most Earth - like regions of Mars or Jupiter's watery moon Europa.

«Telomerase is a unique protein - RNA complex where the protein subunit uses its RNA component as a template to add identical fragments of DNA to the end of chromosomes,» said Emmanuel Skordalakes, Ph.D., associate professor in the Gene Expression and Regulation program of Wistar's NCI - designated Cancer Center.

Although the location of carazolol in the β2 - adrenergic receptor is very similar to that of retinal in rhodopsin, structural differences in the ligand - binding site and other regions highlight the challenges in using rhodopsin as a template model for this large receptor family.

HCV invades cells in the body by binding to specific receptors on the cell, enabling the virus to enter it.2 Once inside, HCV hijacks functions of the cell known as transcription, translation and replication, which enables HCV to make copies of its viral genome and proteins, allowing the virus to spread to other sites of the body.2 When HCV enters the host cell, it releases viral (+) RNA that is transcribed by viral RNA replicase into viral -LRB--) RNA, which can be used as a template for viral genome replication to produce more (+) RNA or for viral protein synthesis.

A team of researchers have developed an open - source, clinically validated template for a 3D printed stethoscope for use in areas of the world with limited access to medical supplies — places where a stethoscope could mean the difference between life and death.

«These origami can be customized for use in everything from studying cell behavior to creating templates for the nanofabrication of electronic components,» says Dr. Thom LaBean, an associate professor of materials science and engineering at NC State and senior author of a paper describing the work.

In a publication presented in RSC Advances, researchers from the division of Nanotechnology and Functional Materials at Uppsala University in collaboration with researchers from Stockholm University for the first time show that it is possible to tailor the pore structure of a mesoporous material, Upsalite ®, without using organic templates or swelling agents, and instead by merely controlling the energy input in the production procesIn a publication presented in RSC Advances, researchers from the division of Nanotechnology and Functional Materials at Uppsala University in collaboration with researchers from Stockholm University for the first time show that it is possible to tailor the pore structure of a mesoporous material, Upsalite ®, without using organic templates or swelling agents, and instead by merely controlling the energy input in the production procesin RSC Advances, researchers from the division of Nanotechnology and Functional Materials at Uppsala University in collaboration with researchers from Stockholm University for the first time show that it is possible to tailor the pore structure of a mesoporous material, Upsalite ®, without using organic templates or swelling agents, and instead by merely controlling the energy input in the production procesin collaboration with researchers from Stockholm University for the first time show that it is possible to tailor the pore structure of a mesoporous material, Upsalite ®, without using organic templates or swelling agents, and instead by merely controlling the energy input in the production procesin the production process.

This approach allowed them to lithographically define oxide templates and fill them via epitaxy, in the end making nanowires, cross junctions, nanostructures containing constrictions and 3 - D stacked nanowires using the already established scaled processes of Si technology.

In the last few decades, the use of DNA as a template for the arrangement of functional elements like organic dyes into precise arrays has undergone rapid advance.

Because redundant copies of the genome make it likely that not all parts will be damaged in exactly the same place, the mingling allows repairs to be made using unbroken sections in one copy as a template to repair the damaged ones, the team suggests.

Scientists have discovered many points of regulation in the process of using a specific DNA template to make a protein, known as gene expression, that allow the cell to control how much of a certain protein is made at a certain time.

Briefly, the purified genomic DNA was used as a template to amplify a fragment of the cxcr4 gene using the specific primers (human CXCR4: 5 ′ - CAACCTCTACAGCAGTGTCCTCATC -3 ′ and 5 ′ - GGAGTGTGACAGCTTGGAGATG -3 ′; rhesus CXCR4: 5 ′ - GGTGGTCTATGTTGGAGTCTGG -3 ′ and 5 ′ - GGAGTGTGACAGCTTGGAGATG -3 ′) in the presence of a 32P - dATP and dCTP.

Specifically, the voxels corresponding to striatum (caudate, putamen, and ventral striatum) and thalamus were defined in the MNI stereotactic space using the Automated Anatomical Labeling atlas (41); thresholding, the simplest method of image segmentation, was used to identify midbrain voxels on a T1 - weighted image (ch2.img; an average of 27 T1 - weighted scans of the same individual that is included in the MRIcro template folder).

Ten microliters of a l / 1000 dilution of the first - round PCR product was employed as a template in a second PCR using PB (5 ′ - CGTACTGGAAAGTGCGGCTG - 3 ′) as the forward primer and P97 (5 ′ - GATGTTCAACTCATCCTGGTCCC - 3 ′) as the reverse primer [19].

The specificity of each assay was determined using cDNA templates in duplicate from uninfected mouse tissues and other pathogens (Leptospira spp., Escherichia coli, Listeria monocytogenes, Staphylococcus aureus, Helicobacter spp.).

Mai T. Khuong and colleagues at the University of California, San Diego, developed a method to synthesize chromatin in vitro using histone chaperone proteins and an adenosine triphosphate - driven motor protein derived by a simple purification from Drosophila, template DNA and histones from the researchers» species of choice, and ATP.

Using his initial finding as a template, other groups have found a requirement for the cellular cytoskeleton in entry of other retroviruses, including HIV.

First, we will use our unique DNA - and chromatin - templated in vitro transcription systems to investigate the direct role of p53 serine18 phosphorylation in sestrin gene activation through modulation of p53 - coactivator interactions.

The assays were painstakingly designed using extremely strict parameters in order to exclude non-human (mouse) templates and target regions of low energy secondary structures, maximizing both specificity and sensitivity.

Institutions responsible for the development of graduate curricula could use the competencies as a template for preparing graduate students so that they can continue their training in these areas as postdoctoral scholars.