Sentences with phrase «use real greens»
HERPTILES Food: San Francisco Bay Brands — Healthy Herp Instant Meals Healthy Herp reptile diets use real greens, vegetables, fruits, meats and insects to create simple, nutritious meals.
http://www.petbusiness.com/ Not exact matches
The work is still in it's early stages — «Any effort to use electric current for stimulating the brain outside the laboratory or clinic could be dangerous and should be strongly discouraged,» Green cautions — but there are already places where the idea of electrical stimulation is being tested out in the real world.
27.11.2015: BuzzFeed 23 Healthier Versions of Your Favorite Holiday Treats 09.11.2015: Well & Good 17 Healthy Drink Recipes to Help You Survive Cold Season 29.10.2015: Holly Grainger 36 Healthy Recipes Using Ancient Grains 14.07.2015: Pop Sugar 15 Seasonal Fruit Smoothies to Cool You Down This Summer 11.07.2015: Trinity's Kitchen The Amazing Benefits of of Turmeric — with 22 delicious plant - based recipes 02.07.2015: My Domaine 10 Delicious Green Smoothies with 5 Ingredients or Fewer 20.05.2015: Community Table 40 Crave - Worthy Veggie Burgers 19.05.2015: Prevention 10 Stuffed Avocado Recipes You're About to Start Craving 13.05.2015: Feed Feed Vegan Desserts 11.05.2015: Lifetrain 5 of The Most Awesome Vegan Blogs 10.05.2015: Choosing Raw Weekend Reading 07.05.2015: Feed Feed Rhubarb 02.05.2015: Rifit 10 Delicious Spring / Summer Smoothies 29.04.2015: London Evening Standard Best Vegan Blogs to Follow for Recipes and Diet Tips 25.04.2015: Healing Smoothies 73 Superpowered Avocado Smoothies 21.04.2015: The Daily Meal Top Vegan Blogs 17.04.2015: The Pretty Bee 40 Delicious Vegan Cupcake Recipes 10.04.2015: The Purple Carrot Vegan Blogs to Follow in 2015 21.04.2015: The Daily Meal Top Vegan Blogs 09.04.2015: Situation Today 18 Killer Vegan Pizzas even Carnivores Will Love 04.04.2015: The Lean Green Bean A Week of Vegan Meals 16.03.2015: Raw High Life Vegan Pizza Roundup: 7 Awesome Options... 13.02.2015: Nest Full of New 17 Delicious and Healthy Spiralizer Recipes 11.02.2015: Dish - y 101 Small Plate Ideas to Make at Home 07.02.2015: Ricki Heller 40 + Sugar - Free Sweets for Valentine's Day (Vegan & Gluten Free) 06.02.2015: The Purple Carrot 7 Lesser Known Blogs You Can't Afford to Miss 06.02.2015: First Site Guide Best Vegan Blogs 05.02.2015: My Darling Vegan Emma's Stuffed Bell Peppers 03.02.2015: Oh My Veggies 68 Delicious Ways to Use Tofu 29.01.2015: Fit Girl's Diary Delicious & Healthy Soups Packed with Protein 23.01.2015: Sheer Luxe Spiralizer Recipes 23.01.2015: Gleam It Up 15 Super Healthy No - Bake Desserts 11.01.2015: Smart Girls Lift 40 + Sensational Smoothies to Sip On 09.01.2015: Connoisseurus Veg 50 Fast and Healthy Vegan Dinners 03.01.2015: Vegan Miam Vegan Baked Custard Tarts 17.12.2014: A Lazy Girl Goes Green 10 Deliciously Vegan Desserts... 07.12.2014: Booya Fitness 7 Healthier Holiday Cookie Recipes 10.12.2014: Running on Real Food Sweet Potato, Beetroot & Ginger Tempeh Sushi 10.12.2014: Foodies 100 20 Vegetarian Christmas Centrepieces 08.12.2014: Keepin» it Kind Emma's Chocolate - Dipped Lemon & Cranberry Shortbread Cookies 04.12.2014: Green Blender Healthy Christmas Recipe Roundup: 12 Christmas Recipes 11.11.2014: Being Content Coconut and Berries» African Inspired Peanutty Millet 05.11.2014: Gram Magazine 10 Vegan Recipes to Celebrate World Vegan Day 25.10.2014: Curiously Conscious Top 100 + British Healthy Living Bloggers 19.10.2014: Choosing Raw Weekend Reading 10.10.2014: The Pretty Bee 30 Comforting Gluten Free and Vegan Soup Recipes 29.09.2014: The Taste Space 11 Ways to Use Blackstrap Molasses 22.09.2014: Ceara's Kitchen Over 30 Vegan Pumpkin Recipes... 18.09.2014: The Body Shop Keeping Summer for a Little Bit Longer 14.09.2014: Gim me Some Oven 15 Easy Vegan Dinner Recipes 08.09.2014: Foodies 100 20 Vegetarian Lunchbox Ideas 07.09.2014: Tinned Tomatoes 21 Quick Vegan Meals for Midweek Dinners 27.08.2014: The Vegan 8 Tons of Yummy Recipes to Share 10.08.2014: Mashable 17 Raw Desserts You Can Make without Baking 05.08.2014: Bring Joy Raw Zucchini Noodles with Creamy Dill Sauce & Mushrooms 03.08.2014: My Natural Family 50 of the Best Easy Vegan Breakfast Recipes 27.07.2014: Oh My Veggies Build a Perfect Meal Bowl (+ 18 Vegetarian Meal Bowl Recipes) 24.07.2014: My Natural Family 30 Paleo Coconut Flour Recipes 17.07.2014: Wendy's Hat Chocolate Caramel Dessert Recipes 06.07.2014: Choosing Raw Weekend Reading 26.06.2014: Keepin» It Kind30 Vegan Pizza Recipes for National Vegan Pizza Day 2014 24.06.2014: The Vegan Woman «The Top 20 Vegan Blogs To Watch»: Second Place 18.06.
Fresh tomatoes, diced onions, diced green peppers, and used real center cut bacon instead of pre-packaged pieces.
I only use real parmesan cheese — nothing out of a green can for me.
In a real pinch you can use a few cans of green chiles although it won't have quite the same flavor.
This is absolutely gorgeous — the contrasting colours of red and green look so pretty, and I love that you used fresh cherries and real pistachios for both colour and flavour.
I love it when used with the greens, it's the real thing.
We only use organic, green, real food stevia powder in Pure Food Protein.
That's why it's the absolute best protein powder to use with those green smoothie recipes... because you're adding real food ingredients instead of a bunch of fillers, gums, and natural flavors.
It can be substituted with the green parts of the scallions; but I have always used the real thing.
Snacks this week: Green Power Smoothie, apple slices with this dip (I be using homemade yogurt), pineapple in homemade yogurt, cucumber and carrot slices with hummus and left over homemade ranch dressing from Thursday night, cantaloupe and watermelon slices, air popped popcorn with real salt and real butter or coconut oil, Granola Bars.
Slow - Cooker Barley and Chickpea Risotto from Foxes Love Lemons Stuffed Portobello Mushrooms With Feta from Real Simple (with Bulgur) Spicy Thai Coconut Quinoa from Chow (gluten - free) Edamame & Veggie Fried Brown Rice from Poor Girl Eats Well (gluten - free if using Tamari or gf soy sauce) Savory Kasha Bowl: Toasted Hazelnuts, Bitter Greens, and Parmesan from Food for my Family (with Buckwheat, gluten - free) Roasted Cauliflower, Freekeh and Garlicky Tahini Sauce from Cookie and Kate
Joining a club of arsenal s stature has its ups and downs.There is a requirement of how our players should perform when on the pitch.The following is a list of players who were wrong to choose arsenal.Aaron ramsey - Even though he is the most favoured of all players at the club now.I cant help but think how it would have gone for Him if he decided to search for other greener pastures.He was a clear talented footballer during his time at cardiff but he hasnt been raised with the discipline at arsenal.You can always see ramseys all round strengths but sadly Its not helping him or the club with his foward moving pleasurr.He is so Over used and its sometimes difficult for him to get used to the rythm of the game.With time you realise he gets low ib confidence and his engine gets wasted.He needed somebody who would have managed him properly and with care and that person is certainpy not wenger.You would have been better off at Manu mate.Calum chambers - Came us a very talented player from southampton with raw talent.He was very good at first but wenger found a way to reduce his level of confidence.His inexperience was left exposed and wenger did nt do anything to resolve that problem and instead He looked for other talented players.Alex oxlade chamberlain - Another very talented player who needed only his skilled sharpened and his character modelled.That and he was ready to become a world beater.But wenger decided to let him run and run like a headless chicken causing him to be often injured and damaging his confidence.Who knows what would have happened to him gad he decided to look for more greener pasture.He is surely a much better player than this.Theo walcott - Another player who was tipped to have a very bright future.He had it in him.But all he needed was an appropriate manager who would nurture him with discipline and help him with his talent.But on Coming to arsenal he was given Much more responsiblities putting more weight on his shoulders on top of that another player who was recklessly managed with his talent and never coming off age because his character wasnt properly shaped.Mesut ozil - Al right i agree he perfoms well just recently.But imagine all the legendary players he was often compared to during his time at real madrid.On coming to arsenal he found no rotation often overused, suffered many injuries and his confidence dwindled.It is pretty clear arsene does not take any responsibility for players.And when at arsenal you have to be your own manager.You need not rely on your manager otherwise you might continue being the same player for the next many years.That is why each and every player are what they are because of their own efforts and wenger had nothing to do with it.Van persie was the same player for over 7 years untill he himself decided to change.Wenger only organises and prepares tge team while the rest is in your court.It is not what so many people make it out to be.Thats why we need to pressure wenger more than our own players.They are their own self managers and wenger needs to take that responsibility
Despite usually having a camera in hand, I forgot mine at home this time so I don't have any pics of my own, but a few of me (pics # 13 & 15 — I'm in the green shirt) have surfaced around the «net (thank you, Use Real Butter (Jen) for proof that I really did go!).
If the economics were the issue, the real «green» lunch would be the school lunch — it's cheap, it uses a central infrastructure (dishes / trays etc. at the school), and with pressure from parents and other interested parties, can be made from healthy, local and organic foods.
Mary Green, Executive Director of the Real Diaper Association, a 501 (c)(3) nonprofit organization that advocates for the use of reusable cloth diapers, [email protected].
The Green Party's new leader has used her first party conference speech to accuse Labour of «failing to offer a real alternative» to the coalition.
Those who know him know that Campbell's gentlemanly and avuncular style conceals a genuine steel and ambition - this is a man, after all, who is used to winning races on the athletics track - and with his «free, fair and green» message (what an English image from a Scotsman) he clearly believes his party will again be a real player in the next election.
According to Lipshutz, palladium is only one key ingredient — albeit an important one — in producing a far greener Suzuki reaction that is applicable to real - world uses.
When it was first proposed, no comparable urban green space could be found in the whole of the United States — and it seemed unlikely that one would arise on land that could be put to other, more profitable use - especially with New York real estate values on a steady rise.
The TMAdV - specific quantitative real - time PCR was performed on a Stratagene MX3005P real - time PCR system using a 25 µL master mix consisting of 18 µL of water, 2.5 µL of 10X Taq buffer, 1 µL of MgCl2 (50 mM), 0.5 µL of deoxynucleoside triophosphates (dNTPs; 12.5 mM), 0.5 µL of each primer (10 µM), 0.5 µL SYBR green, 0.5 µL of Taq polymerase (Invitrogen, Carlsbad, CA), and 1 µL of extracted nucleic acid.
The Stefan - Boltzmann law does not take into consideration the feedback warming effects of the green - house gases, so it can not be used to study the real earth climate.
mRNA expression of DDX3 and p21waf1 / cip1 in adjacent normal liver tissues and HCC samples was examined using quantitative real - time PCR (LightCycler FastStart DNA Master SYBR Green I, Roche Applied Science, Mannheim, Germany) according to the instruction manual using the primer set DDX3 - 4987F, TTCTCAGATGTTTGTTGTGTGGATT; DDX3 - 5142R, AAACTTGCTCAAATGCTATTGCTG; p21 - F, AATCCCAGCTACTTGGAAGGC; and p21 - R, GCTGACTGCAACCTCTGCC.
Real - time PCR was performed using iQ SYBR Green Supermix (Bio-Rad).
For real - time PCR analysis, 1 µL of chromatin was used as template in triplicate reactions using FastStart SYBR Green Mastermix (Roche, Indianapolis IN) on a CFX96 real - time PCR detection system (Bio-Rad, Hercules CA).
Real - time PCR was performed using SYBR Green PCR Mix (Roche; Mannheim, Germany) and an ABI prism 7300 sequence detection system (Applied Biosystems; Foster City, CA).
This real food shamrock shake uses pure peppermint oil extract and naturally green foods like spinach and avocado.
Mary Green, Executive Director of the Real Diaper Association, a 501 (c)(3) nonprofit organization that advocates for the use of reusable cloth diapers, [email protected].
Easier to digest than tablets or capsules and made from a base of real food, the nutrients in Good Green Stuff are supplied in the forms most easily recognised and used by your body.
You will find almost 30 creative, healthy, balanced real - food recipes for inspiring you to use greens in your life!
Two of the brands I alternate using are fermented cod liver oil from Green Pastures and extra virgin cod liver oil from Rosita Real Foods (use coupon code loyal10 for ten percent off).
Stay away from the artificial dyes and use real whole food to colour your dish green.
Detox Green Apple Smoothie This smoothie gets its apple flavor from apple cider, so it has a robust taste since they're using real cider and not the kind that's been sugared up.
Add the avocado, moringa or greens powder, peppermint oil, the pinch of Real salt, vanilla, protein powder (if using)-- blend until smooth.
Our new Green Tea Fiber Brow Builder is formulated with Pro Vitamin B5 and Vitamin E to strengthen hair, and uses fibers of pulverised green tea leaves to mimic real hair growth, resulting in enhanced texture and density for your eyebGreen Tea Fiber Brow Builder is formulated with Pro Vitamin B5 and Vitamin E to strengthen hair, and uses fibers of pulverised green tea leaves to mimic real hair growth, resulting in enhanced texture and density for your eyebgreen tea leaves to mimic real hair growth, resulting in enhanced texture and density for your eyebrows.
are mixed with shorter (1.5 inches wide) light green tips for extra dimension and real beauty Product Features: 240 branch tips Pre-lit with 100 clear mini lights For indoor / outdoor use UL listed 30 inch green lead cord Sturdy metal frame for hanging No assembly required - wreath comes in 1 - piece 120 volts, 60 hertz,.17 amps, 20.4 watts Dimensions: 36 inches diameter (measured from outer tip to outer tip across the wreath) Material (s): PVC / metal / glass bulbs / wire
Longer (3 inches wide) needle pine tips have two - tone green color which... are mixed with shorter (1.5 inches wide) light green tips for extra dimension and real beauty Product Features: 320 branch tips Pre-lit with 150 clear mini lights For indoor / outdoor use UL listed Green lead cord Sturdy metal frame for hanging No assembly required - wreath comes in 1 - piece 120 volts, 60 hertz,.17 amps, 20.4 watts Dimensions: 48» diameter (measured from outer tip to outer tip across the wreath) Material (s): PVC / metal / glass bulbs / wire readgreen color which... are mixed with shorter (1.5 inches wide) light green tips for extra dimension and real beauty Product Features: 320 branch tips Pre-lit with 150 clear mini lights For indoor / outdoor use UL listed Green lead cord Sturdy metal frame for hanging No assembly required - wreath comes in 1 - piece 120 volts, 60 hertz,.17 amps, 20.4 watts Dimensions: 48» diameter (measured from outer tip to outer tip across the wreath) Material (s): PVC / metal / glass bulbs / wire readgreen tips for extra dimension and real beauty Product Features: 320 branch tips Pre-lit with 150 clear mini lights For indoor / outdoor use UL listed Green lead cord Sturdy metal frame for hanging No assembly required - wreath comes in 1 - piece 120 volts, 60 hertz,.17 amps, 20.4 watts Dimensions: 48» diameter (measured from outer tip to outer tip across the wreath) Material (s): PVC / metal / glass bulbs / wire readGreen lead cord Sturdy metal frame for hanging No assembly required - wreath comes in 1 - piece 120 volts, 60 hertz,.17 amps, 20.4 watts Dimensions: 48» diameter (measured from outer tip to outer tip across the wreath) Material (s): PVC / metal / glass bulbs / wire read more
Longer (3 inches wide) needle pine tips have two - tone green color which... are mixed with shorter (1.5 inches wide) light green tips for extra dimension and real beauty Product Features: 720 branch tips Pre-lit with 400 clear mini lights Sturdy metal frame for hanging Some easy assembly required - wreath comes in 4 - pieces Green cord set with replacement fuse For indoor / outdoor use UL listed for seasonal use 120 volts 60 hertz.17 amps 20.4 watts Dimensions: 60» diameter (measured from outer tip to outer tip across the wreath) Material (s): PVC / metal / bulbs / wire readgreen color which... are mixed with shorter (1.5 inches wide) light green tips for extra dimension and real beauty Product Features: 720 branch tips Pre-lit with 400 clear mini lights Sturdy metal frame for hanging Some easy assembly required - wreath comes in 4 - pieces Green cord set with replacement fuse For indoor / outdoor use UL listed for seasonal use 120 volts 60 hertz.17 amps 20.4 watts Dimensions: 60» diameter (measured from outer tip to outer tip across the wreath) Material (s): PVC / metal / bulbs / wire readgreen tips for extra dimension and real beauty Product Features: 720 branch tips Pre-lit with 400 clear mini lights Sturdy metal frame for hanging Some easy assembly required - wreath comes in 4 - pieces Green cord set with replacement fuse For indoor / outdoor use UL listed for seasonal use 120 volts 60 hertz.17 amps 20.4 watts Dimensions: 60» diameter (measured from outer tip to outer tip across the wreath) Material (s): PVC / metal / bulbs / wire readGreen cord set with replacement fuse For indoor / outdoor use UL listed for seasonal use 120 volts 60 hertz.17 amps 20.4 watts Dimensions: 60» diameter (measured from outer tip to outer tip across the wreath) Material (s): PVC / metal / bulbs / wire read more
Longer (3 inches wide) needle pine tips have two - tone green color which... are mixed with shorter (1.5 inches wide) light green tips for extra dimension and real beauty Product Features: 240 branch tips Pre-lit with 100 clear mini lights For indoor / outdoor use UL listed 30 inch green lead cord Sturdy metal frame for hanging No assembly required - wreath comes in 1 - piece 120 volts, 60 hertz,.17 amps, 20.4 watts Dimensions: 36 inches diameter (measured from outer tip to outer tip across the wreath) Material (s): PVC / metal / glass bulbs / wire read more
are mixed with shorter (1.5 inches wide) light green tips for extra dimension and real beauty Product Features: 720 branch tips Pre-lit with 400 clear mini lights Sturdy metal frame for hanging Some easy assembly required - wreath comes in 4 - pieces Green cord set with replacement fuse For indoor / outdoor use UL listed for seasonal use 120 volts 60 hertz.17 amps 20.4 watts Dimensions: 60» diameter (measured from outer tip to outer tip across the wreath) Material (s): PVC / metal / bulbs /green tips for extra dimension and real beauty Product Features: 720 branch tips Pre-lit with 400 clear mini lights Sturdy metal frame for hanging Some easy assembly required - wreath comes in 4 - pieces Green cord set with replacement fuse For indoor / outdoor use UL listed for seasonal use 120 volts 60 hertz.17 amps 20.4 watts Dimensions: 60» diameter (measured from outer tip to outer tip across the wreath) Material (s): PVC / metal / bulbs /Green cord set with replacement fuse For indoor / outdoor use UL listed for seasonal use 120 volts 60 hertz.17 amps 20.4 watts Dimensions: 60» diameter (measured from outer tip to outer tip across the wreath) Material (s): PVC / metal / bulbs / wire
Full discloure: the green and white stockings aren't actually green and off - white in real life (they're red and off - white), but I forgot the cable knit and fur stockings I was going to let her borrow, so I made them match the rest of the display using Photoshop - ha!
Mason jars used to come in all kinds of pretty colors: blue, green, and amber — I love that I can duplicate this look real easily!
bright bedroom colors ideas orange bold designs created with pink and grey, bright bedroom colors ideas using and colorful room design warm, bright orange bedroom warm colors green and grey ideas blue lime interior, bright colors bedroom decor green and grey decoration with light orange color living room, bright bedroom colors ideas orange green and grey awesome master wall, bright orange bedroom living room accessories using colors bedrooms adorable pink and grey soothing, real life colorful bedrooms better homes and gardens bright bedroom paint ideas green grey orange, bright bedroom colors ideas decor orange color schemes yellow bathroom that, bright color living room decor pink and grey bedroom colors ideas making a picture of paint, bright orange bedroom ideas paint whats your color personality using colors living room decor.
paint colors bedroom at real estate colour combination green blue furniture for small spaces, bedroom colors feng shui 2015 black colour 2016 sherwin williams amazing designer wall paints for paint, want a good nights sleep find out which colours you should use to paint bedroom furniture purple ideas for small rooms, best color bedroom office paint colors marine alexander julian colours furniture feng shui 2016, alexander julian colours bedroom furniture cream colored bedrooms best paint colors ideas on blue uk yellow color combination, bedroom colour combination green asian paints colours carpet for black feng shui, bedroom color combinations green colours 2016 uk best wall paint colors master combination, bedroom colors 2016 color combinations green neutral colours ideas traditional double dulux, paint colors for bedrooms amusing decor bedroom colours feng shui couples good small rooms benjamin moore 2015, modern bedroom colours 2016 furniture the best chocolate brown bedrooms ideas on colors feng shui 2015.
We use a scientific matching system that leverages 29 DIMENSIONS ® based on features of compatibility found in thousands of successful relationships — Bowling Green dating has never been more real.
We use a scientific matching system that leverages 29 DIMENSIONS ® based on features of compatibility found in thousands of successful relationships — Green Pond dating has never been more real.
We use a scientific matching system that leverages 29 DIMENSIONS ® based on features of compatibility found in thousands of successful relationships — Green River dating has never been more real.
We use a scientific matching system that leverages 29 DIMENSIONS ® based on features of compatibility found in thousands of successful relationships — Greens Farms dating has never been more real.
We use a scientific matching system that leverages 29 DIMENSIONS ® based on features of compatibility found in thousands of successful relationships — Green Valley dating has never been more real.