It was
used as a primer, here in America, to teach communist agents how to brainwash people, and, in fact, how to subvert entire populations.
Many people
use them as primers for daily meditations or discussions: CLICK HERE.
When I tried
using this as a primer, then I noticed the quality in the product.
This mist is versatile (it can be
used as a primer, setting spray, toner, etc.) and doesn't feel oily.
I also
use it as a primer before any makeup application for both myself and my clients.
I use it as my primer and love that it is moisturizing.
I'm giving it a five star review, but
I use this as a primer, not a foundation.
I use it as a primer / base under my tinted moisturizer or foundation and it gives such a nice healthy glow.
This mist is versatile (it can be
used as a primer, setting spray, toner, etc.) and doesn't feel oily.
We like that it can be
used as a primer, concealer, as well as for treating or protecting the skin.
This setting spray by Too Faced is an all - in - one product, meaning you can
use it as a primer, a refreshing spray, and a setting spray.
I used Aglow (# 20), I use alone with foundation powder for a light finish; I've also
used it as primer w / 2nd Skin foundation (shade # 4) and they are perfect together, providing just the right coverage, long - lasting, and natural looking...thank - you 100 % for making this product!
The Illamasqua Radiance veil is very versatile this way that it can be
used as a primer or you could even try it as a super pigmented highlight and eyeshadow primer which I've done in the past for a more dramatic finish.
I have combination skin, so I can't
use it as a primer under foundation.
I use it as a primer during the week.
I really liked this product at first, I would
use it as a primer and then apply my HD grinding powder over.
This moisturizer can also be
used as a primer, post shave soother, body lotion, and even makeup remover.
During a warm (ish) day in January, I mixed up some DIY chalk paint with Plaster of Paris to
use as a primer.
The shimmery gold formula can be worn alone to brighten the eyes or
used as a primer to add luminosity, creating the perfect canvas for shadow application.
I prefer
using it as a primer under my foundation or mixed in with my liquid foundation for a beautiful subtle and luminous effect.
This is a versatile product that can be
used as a primer, highlighter and moisturizer to add a fresh, dewy glow to any skintone.
I use it as a primer too because it is a little bit tacky which actually gives my makeup something to stick on so it lasts longer.
Smooth Affair Facial Primer & Brightener is supposed to be
used as a primer, to create a smooth canvas for makeup to be applied on top.
Erborian Glow Créme — I reviewed this a while back and am still loving
using this as a primer.
What do you recommend as
I use as a primer (I'd like to cut down on the amount of Annie Sloan).
I use it as a primer or alone when running errands.
Anyway, I went out today and bought the Garnier Brightening & Smoothing Daily Moisturizer and the Monistat Chafing Gel to
use as a primer.
The model should be
used as a primer to look into a dividend growth stock further.
The gesso
he uses as primer is applied onto the canvas in horizontal and vertical strokes with a broom stick, to recreate the warp and weft of woven rugs.
Use this as a primer under your foundation whenever you will be in front of a camera.
It should be
used as primer to fill in your specific information.
Not exact matches
www.dbm.com/jobguide Known
as the Riley Guide, this is a no - frills
primer on
using the Internet for job searching.
A quick
primer on how end - to - end encryption works,
using iMessage
as an example; I'm going to dramatically simplify this explanation, but you can read Apple's security white paper to get the specifics:
But taking the fruits of exegetical method that was taught here at RMS, I got three methods
as a short
primer on what to do with the exegetical work in terms of preaching / teaching: 1, preach off of the exegetical outline (no time to prepare); 2,
use the proper by the book method (Homiletics training); 3,
use Pauls method of explaining the passage doctrinally for up to half, and spend the rest of the time in application.
That's like saying you'd
use Uncle Tom's Cabin
as a
primer on race relations discussions.
A hymnal can be
used as a great
primer for learning about aspects of the faith: grace, reconciliation, sovereignty, redemption, forgiveness of sins and more.
Here are my favorite hydrating tools,
as well
as my the brushes that I
use everyday, along with the
primers and moisturizer.
This multi-functional all - in - one product can be
used as a lightweight lotion, serum and base
primer.
County to Conduct Paint Stabilization Pilot Study «Method of Cost - Effective Interim Lead Hazard Control Sought» The Oneida County Health Department's Lead Primary Prevention Program (LPP), through its New York State Department of Health grant, will conduct a pilot project designed to study the impact of
using new paints containing
primer as a method of stabilizing deteriorating lead paint surfaces in Utica's pre-1978 houses, County Executive Anthony J. Picente, Jr. announced today.
Science writer Arney
uses the «mitten cat» mutation
as a springboard to explain all things DNA in this winning
primer on «the cookbook of life.»
«I'm not convinced those features are the same
as the spicules we see elsewhere on the sun,» Beckers says.Related sites More spicule images and movies
Primer on solar physics Swedish Solar Telescope,
used in the study TRACE satellite, also
used in the study
Adenovirus PCR was performed on a TMAdV - positive clinical sample, a TMAdV culture, and a human adenovirus B culture (
as a positive control)
using an additional 5 pairs of
primers, according to previously published protocols [26], [27], [28] Three of the 5
primer pairs, designed to detect human respiratory adenoviruses B, C, and E, failed to amplify TMAdV [27].
Briefly, the purified genomic DNA was
used as a template to amplify a fragment of the cxcr4 gene
using the specific
primers (human CXCR4: 5 ′ - CAACCTCTACAGCAGTGTCCTCATC -3 ′ and 5 ′ - GGAGTGTGACAGCTTGGAGATG -3 ′; rhesus CXCR4: 5 ′ - GGTGGTCTATGTTGGAGTCTGG -3 ′ and 5 ′ - GGAGTGTGACAGCTTGGAGATG -3 ′) in the presence of a 32P - dATP and dCTP.
cDNA synthesized by reverse transcription of 1 µg RNA primed with oligo (dT) and random 9 - mer
primers was
used as the substrate for quantitation of mRNA expression levels by quantitative RT — PCR in the presence of SYBR ® Green (Stratagene, La Jolla, CA).
(D) RT - PCR detection of mRNA expression originating from the targeted † XP and † XPCS alleles in embryonic stem cell clones
using primers F1 (hybridising outside the targeting construct) and mR
as indicated in (A) results in a 1,416 - bp fragment.
Ribosomal protein S24 (RPS24) gene served
as an internal control for quantitation
using the
primer set TGGCTTTGGCATGATTTATGAT and CTTTTTGCCAGCACCAACATT.
Ten microliters of a l / 1000 dilution of the first - round PCR product was employed
as a template in a second PCR
using PB (5 ′ - CGTACTGGAAAGTGCGGCTG - 3 ′)
as the forward
primer and P97 (5 ′ - GATGTTCAACTCATCCTGGTCCC - 3 ′)
as the reverse
primer [19].
The
primer sequences were essentially the same
as those
used by Moccia et al. [50].
First - round amplification
used PA (5 ′ - GGTATGTTTAGTGAGGG - 3 ′) and P95 (5 ′ GGTTA - GAGCGCAGGTCTG - 3 ′)
as the forward and reverse
primers, respectively.
Skin biopsies were assessed for infection by culture and by standard PCR
using primers targeting flaB, ospA and ospC
as described [35].