Sentences with phrase «used for hybridization»

After acetylation by treatment with 0.1 m triethanolamine 0.25 % acetic anhydride, pH 8.0, the tissue was prehybridized (prehybridization solution: 0.75 m NaCl, 25 mm PIPES, 25 mm EDTA, 5 × Denhardt's reagent, 0.2 % SDS, 250 μg / ml Escherichia coli tRNA, and 500 μg / ml salmon testis DNA, pH 6.8) at room temperature for 5 h. Riboprobes were incubated for 10 min at 85 °C before application onto the sections and used for hybridization at a final concentration of 500 ng / ml.

Not exact matches

I mean, it's as «natural» for us to forage for or grow organic food as it is «natural» for us to use our highly intelligent and adaptive brains to experiment with hybridization and genetic modification in agriculture.

Among other adjustments that could help double fuel economy are turbocharging with smaller, more efficient engines that produce the same level of power; advanced heat management and cooling systems, which reuse the heat produced in the engine for energy; weight reduction, including broader use of high - strength steel that is already in some cars today; better aerodynamics; more efficient air conditioners, transmissions and lighting devices (including headlights); and increased electrification leading to full hybridization with electric motor and regenerative breaking — all of which currently exist.

The team also used a technique called in - solution hybridization to enrich for human DNA and filter out contaminant DNA from microbes.

The test developed by Garcia for the current study used fluorescent in situ hybridization (FISH) to visualize BRAF and its fusion partner KIAA1549 inside cells, allowing researchers to see when these genes were fused together and when they were apart.

They plugged the sequences into an algorithm used for human population modeling, which co-author Daniel Falush modified to allow for hybridization among strains of bacteria.

Using cDNA from brain and oligonucleotides shown in Table 1, we performed PCRs to generate probes for in situ hybridization.

List of primers used for riboprobe generation (in situ hybridization, ISH) and in RT - PCR experiments

We sampled the bees from the surface of the bee ball at 0, 30, and 60 min after formation of the bee ball and examined the Acks - expressing brain regions using in situ hybridization (n = 5, 7 and 7 for 0, 30 and 60 min, respectively).

As the variance of admixture has been used to infer the timing of hybridization and sex - biased admixture, we consider the implications of assortative mating for inferring population history and speciation.

Note that panels showing the results of in situ hybridization in Figure 4, S3 and S4 are collected from some sections that are used for the same in situ hybridization experiments, respectively.

The green line indicates the position of sections that correspond to a middle part of the brain used for this in situ hybridization experiment.

Target preparation and microarray hybridization — Total RNA was extracted from retinal samples using RNeasy Lipid Tissue Mini Kit (Qiagen) and was the substrate for amplification and labeling using a procedure based on the Eberwine protocol [49].

Statistical analyses of the number of Acks signals detected in in situ hybridization experiments using sections corresponding to the middle brain parts (n = 5, 5, and 4 for 0, 30, and 60 min, respectively) revealed that there was a significant increase in the number of Acks signals at 30 and 60 min after the bee ball formation in both the Class I and the Class II KCs, and at 60 min after the bee ball formation in the brain area between the DLs and the OLs, and in the OLs (Figure 4S).

Plants used for scanning electron microscopy, RNA - seq, in situ hybridization, metabolic profiling, and PCZ treatment were grown in a high - light growth chamber under short - day conditions (31 °C / 22 °C [day / night], 12 h light / 12 h dark, 50 % relative humidity, chamber outfitted with 6 T8 fluorescent 5 - foot bulbs per 10 - square - foot canopy, light intensity at 200 µmol m − 2 s − 1 PAR) at the Danforth Center's growth facility.

The scientists are focusing mainly on annotating both genomes and collecting additional genomic information using «subtractive hybridization» methods for related strains of bacteria.

The fact that the SNPs used for each of these loci fall on the branch uniting divergent haplogroups, which is consistent with ancient vicariance and reciprocal monophyly being attained in the past before hybridization took place, suggests that high levels of admixture may have eroded any clinal differentiation in HPRT1.

Templates for in situ hybridization probes were amplified by PCR from those plasmids by using the forward primers and reverse primers with or without a T3 promoter site (TATTAACCCTCACTAAAGGGAA) attached to their 5 ′ end.

Using our own data and publically available data from array comparative genomic hybridization (aCGH), we identified a minimal deletion for the cardiomyopathy associated with del1p36 that included only the terminal 14 exons of the transcription factor PRDM16 (PR domain containing 16), a gene that had previously been shown to direct brown fat determination and differentiation.

We obtained polymorphism and divergence data from six individuals for each of the rabbit subspecies using Illumina sequencing of genomic regions enriched by DNA hybridization on microarrays [60].

We also describe a method for the bulk testing of the hybridization characteristics of chromosome - specific clones spotted on microarrays by use of DNA amplified from flow - sorted chromosomes.

Fluorescence in situ hybridization (FISH) was used to screen for the presence of XMRV genomic sequences in formalin - fixed, paraffin - embedded (FFPE) tissue sections from VP62 (2012) and 19 newly collected tumors (a subset of the 39 individuals in the prospective study).

It's smaller that the cotton we're used to seeing in the U.S., but has attracted the attention of cotton growers around the world for potential hybridization with more water - depending versions of the crop.