Sentences with phrase «used primer»

We've never used primer on walls, but we've only had to cover lighter colors.

Should have read the directions and used a primer.

For our kitchen cabinets we used a primer and opted out on the sanding to save time, but because we only had 10 drawers / doors in the bathroom we decided to sand them down.

Hi Kerri — If you used primer initially you would not have had to sand so much or sanded less.

When I did our kitchen cabinets, I lightly sanded them, wiped them clean with a damp rag and then used a primer under the paint.

$ 70 for the 2 RASTs $ 20 for curtains $ 30 for drawer pulls $ 10 for brushes $ 5 for sanding paper and wood fill $ 5 for a can of white spray paint (I actually used primer) $ 15 for the stain $ 20 for Polycrylic $ 10 for craft iron $ 10 for chevron paper

(I used a primer + paint spray — Valspar Outdoor) and it's simply hanging on a sturdy nail.)

I've used their primer for years, but after this project, -LSB-...]

I've used their primer for years, but after this project, I can also vouch for their Complete Coat ™ paint.

So on the bottom piece, I used primer first and didn't have any issues with the paint chipping.

Hey Sofia, I used a primer and a little bit of black pencil liner close to my lash line.

I found it applied best if I used primer or moisturizer first.

It had so many layers of paint that I had to strip it and it took about 5 coats to stop it from bleeding AND I used a primer!!!

I used a primer first, then 3 coats of chalk paint, after a couple days I started to apply the clear wax and noticed the paint is cracking.

I used primer (smashbox) and translucent setting powder (nyx) with enough drops for «medium» coverage.

So on the bottom piece, I used primer first and didn't have any issues with the paint chipping.

I have used this primer few times and it works well to keep the makeup in place, I had no issues using this and been a nice addition to my primers.

I have not used the primer underneathe, though I had put it after applying the concealer.

While I've never used a primer (remember, simplicity is key to my makeup routine), you don't even need one with this great moisturizer!

Again, I used primer and powder and the same result.

I never used a primer before, and this was my first time using one..

I have honestly never used a primer that gave my skin the sort of natural glowy, dewy, healthy

No but I'm sure they used a primer.

Plus, the shadows glided on effortlessly with my shadow brushes, and when I used a primer beforehand I was pleased with the staying power.

Plus, they didn't crease when I used primer beforehand — and stayed on for a good 6 hours without needing a touch up.

No but I'm sure they used a primer.

How To Use: The Facial Powders are suitable for all skin types and should be applied after using our Primer Drops.

Of course, on days when I don't feel like bothering with the whole routine I just use the primer to help even out my skin tone.

Use a primer and moisturizer.

I've never been one to make sure I use a primer before applying my makeup.

Because no kakusei homolog had been identified in any other animal species, including insects, however, we first amplified parts of kakusei cDNA from the Japanese honeybee using primers designed from the European honeybee kakusei cDNA sequences.

The V3 - V5 regions of the 16S rRNA gene were amplified from genomic DNA using primer 357F (5 ′ - CCTACGGGAGGCAGCAG - 3 ′) and barcoded primer 926R (5 ′ - CCGTCAATTCMTTTRAGT - 3 ′).

(D) RT - PCR detection of mRNA expression originating from the targeted † XP and † XPCS alleles in embryonic stem cell clones using primers F1 (hybridising outside the targeting construct) and mR as indicated in (A) results in a 1,416 - bp fragment.

NS5 region of positive mosquito pools for ZIKV NS5 were amplified and sequenced using primers FD3 / FU1 described previously [1] A blast alignment of the ZIKV NS5 sequences showed 97 to 100 % similarity with ZIKV strain ArD41519 (accession number HQ234501) isolated in Kedougou, South - Eastern Senegal, in 1984.

The insert was amplified using the primers M13R / M13F and then purified using the QIAquick gel extraction kit.

Ribosomal protein S24 (RPS24) gene served as an internal control for quantitation using the primer set TGGCTTTGGCATGATTTATGAT and CTTTTTGCCAGCACCAACATT.

mRNA expression of DDX3 and p21waf1 / cip1 in adjacent normal liver tissues and HCC samples was examined using quantitative real - time PCR (LightCycler FastStart DNA Master SYBR Green I, Roche Applied Science, Mannheim, Germany) according to the instruction manual using the primer set DDX3 - 4987F, TTCTCAGATGTTTGTTGTGTGGATT; DDX3 - 5142R, AAACTTGCTCAAATGCTATTGCTG; p21 - F, AATCCCAGCTACTTGGAAGGC; and p21 - R, GCTGACTGCAACCTCTGCC.

Immune complexes were than isolated with E.coli tRNA / Protein A agarose beads, and the obtained purified DNA with subjected to qPCR using primers for HMOX1 E2 promoter.

Skin biopsies were assessed for infection by culture and by standard PCR using primers targeting flaB, ospA and ospC as described [35].

To evaluate whether loss of ABL kinases affected TAZ activity, we performed chromatin immunoprecipitation (ChIP) analysis using primers for TAZ targets identified by ChIP sequencing analysis (42).

Standard PCR and RT - PCR for ospA, ospC and flaB were also performed with either SCID mouse tissues or XT midguts using primers described elsewhere [35].

PCR amplification was performed on genomic DNA using the primer pair forward: 5 ′ CTTGATTCTGGTATTGAGCCAGT 3 ′, reverse: 5 ′ TGAGCTGGTCTGAATGTTCG 3 ′, amplified for 35 cycles at an annealing temperature of 62 °C with Q5 polymerase (NEB) using the manufacturer's standard conditions.

The immunoprecipitated chromatin by anti — IRF - 9 antibody was analyzed by PCR using primers specific for RIG - G promoter sequences (+11 to − 288).

Fifty - base CCHa2 - R - specific genomic homology arms were added by PCR using the primers below (genomic homology in lower case, cassette homology in upper case):

Using these primers, fragments of approximately 1200 - bp, 1000 - bp, 1500 - bp, 1300 - bp, 4300 - bp and 1800 - bp were obtained.

The XMRV specific assay uses the primers GAG - O - F and GAG - O - R and GAG - I - F and GAG - I - R for the primary and nested PCRs, respectively, and conditions as previously described [11, 12].

RT - PCR analysis of RNA from mouse embryonic and adult gonads using primers corresponding to either exons 3 and 9 (upper panel, 501 - bp band) or exons 3 and 12 (lower panel, 847 - bp and 712 - bp bands) reveals that full - length Bol1 is only expressed in postnatal testes, while Bol2 lacking exon 11 is also detectable at low levels throughout gonadal development in addition to its high adult testis expression.

SNPs can be useful by enabling the design of an allele specific PCR using primers including the SNP.

We amplified cDNA from wild - type and mutant ovaries (and genomic DNA as a control) using primers located in the exons flanking the mutation.

(D) RT - PCR using primers spanning exons 2 to 4 further confirmed the complete absence of wild type transcripts.