Sentences with phrase «used quantification»

Here are three aspects where the candidate used quantification to make their resume more clear and impactful (shown in bold):

Here are three areas where the candidate used quantification to make their electrical engineer resume more effective and impressive to a hiring manager.

We also assess performance in real 16S data, where we reanalyze previous genetic association data to show that relative to other widely used quantification methods Karp reveals a larger number of microbiome quantitative trait association signals.

We also describe factors that may influence your quantification choices and provide an overview of the 10 commonly used quantification methods.

Several MR methods have been proposed over the last decade to obtain quantitative estimates of the tissue blood oxygen saturation (StO2) using a quantification of the blood oxygen level dependent

Not exact matches

We agree that there is an element of arbitrariness in many of the quantifications we have used.

A new joint International Dairy Federation (IDF) / International Organization for Standardization (ISO) Standard (ISO 19344 IDF 232) has just been released to provide a method for the quantification of lactic acid bacteria by flow cytometry in fermented products, starter cultures, and probiotics used in dairy products...

The following table provides additional detail on the quantification methods used to gather data at different stages as well as the estimated uncertainty.a

Findings: Thirteen of 22 (59 %) products contained below the limit of quantification for gluten which is 5 ppm for the assay used.

Moreover, a companion document, Guidance on FLW Quantification Methods, provides detailed guidance regarding 10 quantification methods that are commonly used to quantify lost oQuantification Methods, provides detailed guidance regarding 10 quantification methods that are commonly used to quantify lost oquantification methods that are commonly used to quantify lost or wasted food.

The FLW Standard does not require that you use a particular quantification method because the quantification method (s) you choose will be influenced by your particular goals, the scope selected for your food loss and waste inventory, the human and financial resources available, and whether you have direct access to the physical lost or wasted food.

Identification and quantification of drugs and drug metabolites in human breast milk using gas chromatography mass spectrometry computer methods.

The new proposed model could allow a better quantification of the impacts that will likely occur under changing climate and could be considered in future ocean resources and land use management.

The panel can be used as a tool kit for screening and profiling of functional lncRNAs, or as an accurate quantification to validate functional lncRNAs in microarray or RNA - sequencing data.

Although the quantification of the individual active constituents of TCHM is difficult, the use of HPLC - PDA has enabled analytical quality control of some herbal preparations.

This point - of - care device automatically captures and analyzes videos of microfilarial motion in whole blood using motorized sample scanning and onboard motion detection, minimizing input from health care workers and providing a quantification of microfilariae per milliliter of whole blood in under 2 min.

Gary Geernaert, director of DOE's Climate and Environmental Sciences Division, states that «it is critical that federal investments to advance climate science for use by both public and private stakeholders must place significant priority on incorporating uncertainty quantification methodologies into modeling frameworks.

Analyses using the tool suggest that proposed funds to combat Zika in the US and other countries would be cost - effective, based on quantification of the serious health conditions associated with Zika infection.

«The method we used involved the sequencing and quantification of RNA molecules in individual cell fragments, something that was never done before,» says Dr. Thijs Ettema, associate professor at the Department of Cell and Molecular Biology, Uppsala University, who led the study.

Rosenfeld and his students have developed an aerosol quantification method that uses satellite - based measurements of the infrared light reflected by clouds.

To determine the effects of the loss of IL - 15Rα on exercise performance in vivo, we quantified activity of IL - 15Rα — KO mice and B6129 control mice using two different assays: cage wheel running and quantification of photobeam breaks.

Improvement of in Vivo Quantification of [123I]- Iodobenzovesamicol in Single - Photon Emission Computed Tomography / Computed Tomography Using Anatomic Image to Brain Atlas Nonrigid Registration

His research interests in proteomics include the discovery of normal and disease markers using targeted quantitative mass spectrometry and the quantification of protein detection and protein modifications.

Quantification of fibronectin matrix assembly sites using a novel ELISA assay.

About Pelago Bioscience AB Spun out from Karolinska Institutet, Stockholm Sweden, PelagoBioscience AB (http://pelagobio.com) was founded to provide and develop the patented Cellular Thermal Shift Assay (CETSA ®) for use in determination and quantification of drug — target interactions.

(d) Quantification of microvessel density (MVD) in CD34 - stained plugs using HUVEC - BP shTie2 co-culture spheroids normalized to HUVEC - BP shCtr co-culture spheroids.

Quantification of HNF4α immunostainings showed that over 90 % of hiPS cell - derived hepatocytes differentiated using our protocol express HNF4α [4].

Identification and quantification of BRs were performed using Agilent MassHunter Qualitative Analysis software (Agilent Technologies).

Quantification of volume, mass, and density of thrombus formation using brightfield and differential interference contrast microscopy.

Quantification of rapid Myosin regulatory light chain phosphorylation using high - throughput in - cell Western assays: comparison to Western immunoblots.

(b) Quantification of average sprout length in in vitro sprouting assay using HUVEC - BP shTie2 co-culture spheroids normalized to HUVEC - BP shCtr co-culture spheroids.

Absolute quantification of gene expression in biomaterials research using real - time PCR.

Quantification of diabetes comorbidity risk across life, using nation - wide big claim data, further revealed age - related sex differences (335).

Quantification of lipids in human lower limbs using yellow bone marrow as the internal reference: gender - related effects

Actin was used as a loading control and all proteins were normalized to actin for quantification purposes.

RNA - seq reads were aligned to the human genome (hg19 / GRCh37) using TopHat41 (v1.4) and Gencode annotation v1926 was used for gene quantification.

In vitro transcription and quantification of transcribed RNA was performed as previously described [26] with a slight modification consisting of DNA digestion using the DNAfree kit (Ambion, Austin, Texas, USA) instead of DNASE digestion and TRIZOL purification.

We used mRNA sequencing data from the GTEx project (V6, Supplementary Table 1 and 2), and the derived gene and transcript quantifications obtained on Gencode26 V19.

Purified amplicons are quantified using the KAPA Library Quantification Kits for Illumina ® platforms.

We will use as an example the quantification of tubulin polyglycylation in wild - type testes and in Bug22 mutant testes, which present defects in the deposition of this posttranslational modification.

Tissue samples were homogenized to a final concentration of 10 % weight per volume, and a modified Lowery method was used for protein quantification.20 After separation with SDS - PAGE, proteins were transferred electrophoretically to an Immobilon - P membrane (Millipore, Bedford, Massachusetts) overnight and incubated with a mouse monoclonal anti-TPH2 antibody (1:500; Sigma - Aldrich, Saint Louis, Missouri).

DNA for the quantification of Wolbachia was extracted using standard phenol - chlorophorm protocol.

A Taq - Man Real Time assay was used for the specific quantification of mtDNA HVS1 (np 16,103 — 16,233) in the obtained extracts using a Taq - Man - MGB probe 5 ′ - AATACTTGACCACCTGTAGTAC (np 16,138 - 16,159) and primers L16123 (forward)(5 ′ - ACTGCCAGCCACCATGAATATT, np 16,103 — 16,123) and H16209 (reverse)(5 ′ - TGGAGTTGCAGTTGATGTGTGA, np 16,209 — 16,233).

We have in - house computational pipelines built for metagenomic viral discovery, RNASeq quantification, exome sequencing and whole genome sequencing for variants detection using GATK, Affymetrix & Illumina expression array and SNP chips, GWAS, digital PCR analysis, mass spectrometry and biomarker discovery.

• Aislinn Walton, West Texas A&M University, third place, Quantification of Water and Nutrient Use by Invasive Weed Species in Limited Irrigated Corn Production Systems to Optimize Water Use Efficiencies and Economic Returns.

When used with mass cytometry, PLAYR allowed for the simultaneous quantification of more than 40 different mRNAs and proteins.

Using this information, we will then take advantage of recent advances in the quantification of assembly to screen candidate small - molecule libraries for enhanced activity in assembly acceleration, inhibition, and misdirection.

I use ocean and adjoint modelling as well as tools from uncertainty quantification to study sensitivities and uncertainties of ocean circulation.

This downloadable application note by BMG LABTECH provides you with predefined protocols in the CLARIOstar ® microplate reader that you can use for protein quantification experiments.

DNA libraries were then re-amplified for another 13 cycles in quintuplicates or sextuplicates, followed by pooling and purification, visual inspection on a 3.5 % agarose gel, and final quantification using a NanoDrop 2000c spectrophotometer (FisherScientific).