Sentences with phrase «uses rhesus»

Not exact matches

Using this new method, Lemay and colleagues identified 1,606 proteins in human milk and 518 proteins in rhesus macaque milk.

NEW DELHI — Armed with a government order and escorted by police, animal activists yesterday seized and released into the wild 50 rhesus monkeys being used for testing a new drug.

Using young rhesus monkeys in our model of anxious temperament is critical as brain structure and function in non-human primates closely resembles that of humans.»

The researchers used a large dataset spanning 21 years and including 910 adult female rhesus macaques in Puerto Rico.

In later endeavors, Nicolelis trained rhesus monkeys to use brain - machine interfaces to control robotic limbs, and later, the 3 - D movements of an avatar — animated versions of themselves on a digital screen.

This neon swirl was inspired by the neural architecture of a rhesus macaque brain, used by Modha to help him design the chip.

Using these images and 20 years of genetic parentage data, the researchers assessed whether the variation in red ornaments influenced fecundity — that is they produced more offspring — and is heritable in male and female rhesus macaques, two necessary conditions for the trait to be considered under sexual selection.

The study chronicles the use of Vasalgel ™ in groups of rhesus macaques — confirming previous preclinical findings in rabbits on the efficacy of the new device and offering a new tool to colony managers.

The researchers have focussed their attention on the activity patterns of 237 neurons that had been recorded some years previously using electrodes implanted in the frontal lobes of two rhesus monkeys.

Using this new method, Lemay and colleagues identified 1,606 proteins in human milk and 518 proteins in rhesus macaque milk.

A rhesus monkey uses thought to make a robot walk, paving the way for paralysis victims to move using brain - powered prosthetic limbs

Using a process called somatic cell nuclear transfer (SCNT), a team from Oregon Health & Science University (O.H.S.U.) in Portland implanted the contents of individual skin cells from adult male rhesus macaques into each of 304 macaque egg cells stripped of their genetic material.

In 2008, Andrew Schwartz of the University of Pittsburgh in Pennsylvania published a landmark paper describing how two rhesus macaques learned to feed themselves marshmallows and fruit using a crude robotic limb controlled by electrodes implanted in their brains (Nature, DOI: 10.1038 / nature06996).

In a study led by Michigan State University, scientists have shown that gene editing using CRISPR / Cas9 technology can be quite effective in rhesus monkey embryos ¬ - the first time this has been demonstrated in the U.S.

The CMU team used PisCES to follow neural gene expressions from conception through adulthood in rhesus monkey brains to find out what genes work together during different points of development.

Whole blood from rhesus macaques (Macaca mulatta) housed at the Tulane National Primate Research Center was used for CD4 + T cell isolation and ZFN treatment.

All rhesus macaque experiments were approved by the Tulane Institutional Animal Care and Use Committee approval (Protocol P0085; Project 3520) The Tulane National Primate Research Center (TNPRC) is an Association for Assessment and Accreditation of Laboratory Animal Care accredited facility (AAALAC # 000594).

One ZFN pair was used to target both the human and rhesus macaque CXCR4 genes since the 24 bp target sequences are identical.

We designed ZFNs specific to the human and rhesus CXCR4 and CCR5 genes using a previously described approach [29].

Briefly, the purified genomic DNA was used as a template to amplify a fragment of the cxcr4 gene using the specific primers (human CXCR4: 5 ′ - CAACCTCTACAGCAGTGTCCTCATC -3 ′ and 5 ′ - GGAGTGTGACAGCTTGGAGATG -3 ′; rhesus CXCR4: 5 ′ - GGTGGTCTATGTTGGAGTCTGG -3 ′ and 5 ′ - GGAGTGTGACAGCTTGGAGATG -3 ′) in the presence of a 32P - dATP and dCTP.

Already, Graham said, VRC researchers have shown that passive immunization with VRC01, one of the broadest and most potent bNAbs identified in recent years, can protect rhesus macaques from virus challenge, adding that VRC01 is now ready to be used in human trials.

Efficient gene transfer into rhesus repopulating hematopoietic stem cells using a simian immunodeficiency virus - based lentiviral vector system.

The research team at Oregon Health & Science University used skin cells from rhesus macaque monkeys to create the cloned embryos.

While mice, guinea pigs, dogs, rabbits and monkeys have been used as animal models to study B. burgdorferi infection, rhesus macaques have been shown to most closely recapitulate the multi-organ nature and progression of human LD [26, 27].

The most common animals that are used in preclinical tests of HIV prevention products are mice, rabbits, and rhesus macaque monkeys.

During the lecture, Picker discussed his work showing that an extensive treatment with CMV, a persistent virus that stays in the body without causing symptoms, can be used to target and clear SIV, a close cousin of HIV that infects rhesus macaques.

This summer, the centers also began initial sequence production for creating a reference version of the genome of the rhesus macaque, which is a monkey that is widely used in studies of human immunodeficiency virus (HIV) infection.

In the late 1980s, more researchers from India were conducting experiments with casein and cancer — but this time used different doses of aflatoxin, and studied rhesus monkeys instead of rats.

The impact of the full program (prenatal and infancy home visitation) on children's use of alcohol and number of sexual partners is important because recent evidence indicates that alcohol use prior to age 15 years multiplies the risk of alcoholism in adulthood26 and multiple partners increase the risk for sexually transmitted diseases, including human immunodeficiency virus infection.27, 28 The effect of the program on alcohol use is consistent with greater alcohol consumption observed among adult rhesus monkeys who experienced aberrant rearing.29 These findings must be tempered, however, with an acknowledgment of their limitations.