Sentences with phrase «using primer sets»

Ribosomal protein S24 (RPS24) gene served as an internal control for quantitation using the primer set TGGCTTTGGCATGATTTATGAT and CTTTTTGCCAGCACCAACATT.

mRNA expression of DDX3 and p21waf1 / cip1 in adjacent normal liver tissues and HCC samples was examined using quantitative real - time PCR (LightCycler FastStart DNA Master SYBR Green I, Roche Applied Science, Mannheim, Germany) according to the instruction manual using the primer set DDX3 - 4987F, TTCTCAGATGTTTGTTGTGTGGATT; DDX3 - 5142R, AAACTTGCTCAAATGCTATTGCTG; p21 - F, AATCCCAGCTACTTGGAAGGC; and p21 - R, GCTGACTGCAACCTCTGCC.

Not exact matches

Oh do nt forget that to anyone who actually knows something about the laws of physics and metallurgy, that in order to eliminate a large variance in repeatability, you will have to by law, dictate the material, and properties of the components for the firing pins, shell casings and primers for every single firearm made (designers and manufacturers set these material properties and types during design based on use and cost), since this or any other law does not, and it is so easy to beat, any claim to this being smart is f# # $ % $ # stupid.

Using PCR with a different set of short primers from Clark's, her findings seem to corroborate Clark's and Oliver's works: She has identified B. andersonii, B. americana and classic B. burgdorferi in lone star ticks and their close relatives Amblyomma cajennense, found from the U.S. / Mexican border down through South America.

The authors of this study have developed a universal primer set across flowering plants that amplifies 3 - 15 kilobase fragments, which can then easily be sequenced using recently developed next - generation sequencing technologies.

To obtain cDNA fragments of the kakusei homolog in Japanese honeybee, PCR was performed using a set of primers designed based on the nucleotide sequence of the European honeybee kakusei, 5 ′ - GGGGAAGCCAGGAGCCGCGGGTTTACAT - 3 ′ and 5 ′ - AGGCAACAGCACACCATGGGCCTTGGAT - 3 ′, with Ex Taq (Takara, Tokyo, Japan).

The abundance of each barcoded clone can then be monitored over time by sequencing the barcodes in the population (all barcodes can be amplified using the same sets of forward and reverse primers).

Purified and diluted PCR amplicons and a set of six pre-diluted DNA standards are amplified by quantitative (qPCR) methods, using the KAPA SYBR ® FAST qPCR Master Mix and primers.

To prepare UAS overexpression constructs, the entire open reading frames of GBP1 and GBP2 were isolated by RT - PCR using cDNA made from w1118 wandering larvae with primer sets as described in S1 Table.

Tissue DNA was subjected to amplification of a region within the 5s - 23s ribosomal genes using a nested set of primers.

Depending on the region of JAK1 to be sequenced, different sets of primers were used to amplify and sequence JAK1 PCR product (available upon request).

Cell clones that did not survive a 3 day mycophenolic acid treatment were assumed to be AID negative and candidates were further confirmed by PCR using the AID - specific primer - set 5 ′ cccagatcttgcttgtgaagtcttcttattgctg 3 ′ / 5 ′ cccgctagcgccaccatggacagcctcttgatgaagagga 3 ′.

The primers used and which species were screened with each set are detailed in the Supplementary information, Additional file 1: Table S1.

This mist is versatile (it can be used as a primer, setting spray, toner, etc.) and doesn't feel oily.

I also use PhytoPigment Primer, which sets this foundation so well, and the CC cream.

It's a bit wet when applied but after being lightly set with power it lasts me every day from morning till night when I take it off (I don't usually use primer unless I expect it to be hotter), on warmer days I sometimes have to re-powder in the late afternoon once.

This mist is versatile (it can be used as a primer, setting spray, toner, etc.) and doesn't feel oily.

Here are the products I used for this particular face: Face: MAC Prep + Prime Skin Primer MAC Studio Fix Fluid Foundation in NW10 Anastasia Beverly Hills Clear Brow Gel Anastasia Beverly Hills Beauty Express Brow Powder in Brunette Korres Zea Mays blush in Pink MAC powder blush in Taupe Benefit High Beam illuminator NYX Long Lasting Makeup Setting Spray in Matte Finish Eyes: MAC Longwear Paint Pot in Painterly NYX Jumbo Eye Pencil in Black Bean ipsy + NYX neutrals trio palette (all shades) Sonia Kashuk eyeshadow quad in Queen of the Blues (glitter shade, frosty blue shade) Urban Decay 24/7 Glide - on Eyeliner in Zero NYX Big and Loud lash primer Clarins Be Long mascara in Intense Black Lips: MAC Prep + Prime lip primer Obsessive - Compulsive Cosmetics Cosmetic Colour pencil in Anti-Feathered MAC Amplified lipstick in Saint Germain MAC Mineralizeglass lip gloss in BeautifulPrimer MAC Studio Fix Fluid Foundation in NW10 Anastasia Beverly Hills Clear Brow Gel Anastasia Beverly Hills Beauty Express Brow Powder in Brunette Korres Zea Mays blush in Pink MAC powder blush in Taupe Benefit High Beam illuminator NYX Long Lasting Makeup Setting Spray in Matte Finish Eyes: MAC Longwear Paint Pot in Painterly NYX Jumbo Eye Pencil in Black Bean ipsy + NYX neutrals trio palette (all shades) Sonia Kashuk eyeshadow quad in Queen of the Blues (glitter shade, frosty blue shade) Urban Decay 24/7 Glide - on Eyeliner in Zero NYX Big and Loud lash primer Clarins Be Long mascara in Intense Black Lips: MAC Prep + Prime lip primer Obsessive - Compulsive Cosmetics Cosmetic Colour pencil in Anti-Feathered MAC Amplified lipstick in Saint Germain MAC Mineralizeglass lip gloss in Beautifulprimer Clarins Be Long mascara in Intense Black Lips: MAC Prep + Prime lip primer Obsessive - Compulsive Cosmetics Cosmetic Colour pencil in Anti-Feathered MAC Amplified lipstick in Saint Germain MAC Mineralizeglass lip gloss in Beautifulprimer Obsessive - Compulsive Cosmetics Cosmetic Colour pencil in Anti-Feathered MAC Amplified lipstick in Saint Germain MAC Mineralizeglass lip gloss in Beautiful Moves

This setting spray by Too Faced is an all - in - one product, meaning you can use it as a primer, a refreshing spray, and a setting spray.

Spritz your brush with a setting spray and make sure you're using a primer base for your eyeshadow; the product will work for you and if you do it right, it's absolutely gorgeous.

Remember to use a primer before applying the eye shades so they stay set and do not fade away as the function goes on.

Smashbox Photo Finish Primer Water: I love using this spray as either a makeup setting spray, or to add hydration to my foundation.

Natural foundation is totally used to daily compliments but it'd be nice, every once in a while, to give natural face primer some props for setting the perfect canvas.

You can use the Black Lacquer Lash Primer as a base coat before mascara, afterward to set mascara, or by itself for a natural tinted look.

I actually used three different sets, the Light It Up Primer Set, The Light It Up Eyes / Contour / Lips Set and the Light it Up Mascara Set.

I definitely use concealer and corrector, which I then set with powder but still experience some fine lines so I think I will have to ry using a primer first to see if it helps further x

I have oily / combo skin and I used a good primer and setting spray but this foundation just didn't do it for me, I may have to switch to a high end foundation.

Starting with my face, I apply my favorite Dior primer (review here), Urban Decay setting spray (review here) and then use my Beauty Blender to apply my favorite Makeup Forever foundation (review here).

I also used the face primer which went on like silk and I think helps to set the make - up.

Face primers are just that, they set the skin up for the make up no matter what is used.

I use the primer and then spray my face with the Peach Mist Mattifying Setting Spray, and I'm good to go!

Use water or setting spray for extra shimmer and glitter primer to prevent fall - out.

Because I treat it as foundation, I use a primer and a setting spray.

I don't want to mislead you, my skin didn't magically transform into an airbrushed miracle, BUT, I can attest, my makeup did go on extremely smooth and set much better than usual... it was like a I had used a REALLY REALLY good primer.

I grabbed this Too Faced HangoveRX 3 - in - 1 Replenishing Primer and Setting Spray product from Amazon and I have been using it for the past month or so to see how I liked it.

After my moisturizer, primer and foundation are on, I use this brush to apply setting powder.

Primer: Smashbox Foundation: Estēe Lauder (shade: Ivory Beige) Foundation Brush: Sigma Concealer: Tarte (shade: Fair) Blender: Real Techniques Bronzer: Stila Bronzer Brush for Face: Real Techniques Bronzer Brush for Nose: MAC Setting Powder: Urban Decay Powder Brush: Kat Von D Eyeshadow Primer: MAC Eyeshadow One: Urban Decay (shade: Dusk, using this brush) Eyeshadow Two: Urban Decay (shade: Factory, using this brush) Eyeshadow Three: Urban Decay (shade: Darkside, using this brush) Eyebrows: Anastasia Beverly Hills (shade: Taupe, using this brush) Eyeliner: Urban Decay (but I LOVE and HIGHLY recommend Marc Jacobs) False Lashes: Ardell Eyelash Glue: Duo Mascara: Estēe Lauder Blush: Tarte (shade: Peachy Nude, using this brush) Highlighter: Becca (shade: Opal, using this brush) Lipliner: Stila (shade: Pink Moscato) Lip: Stila (shade: Baci)

The best thing is to use an eye primer, like Lancôme Aquatique Waterproof Eyecolour Base ($ 26; lancome-usa.com), to brighten and tone down any discoloration and darkness, says Barose, setting it with a loose powder.

I used it with, moisturizer, NYX pore filler primer, applied it with cheap - o ELF foundation brush, and set it with Be Nye powder in Banana.

The wear time with this blush is pretty good on me, lasting around 6 - 10 hours depending on which primer and setting spray I used.

When worn over a primer, it breaks down and wears off quickly and using a setting powder did not help.

I used primer (smashbox) and translucent setting powder (nyx) with enough drops for «medium» coverage.

Marc Jacobs Remarcable Foundation PRODUCTS USED Marc Jacobs Remarcable foundation MJ Face Brush MUFE Hydrating Primer Nars Custard Concealer Sephora Buttercream concealer Laura Mercier Translucent setting -LSB-...]

I always use a primer to start my makeup routine & set with powder for all - day wear.

There are different schools of how makeup professionals use this miracle product on set (in fact, for some artists this product is their best - kept secret), what I've seen is that some people use it not only as a primer and moisturizer but also as a makeup remover.

Hi Diane, I'm doing an old antique bed room suite it's been in the family over 50 years and then some I want to make it right as is have around five pieces to do what do you think I should use and steps I should take should I sand then primer and use pop with a satin or flat paint the bedroom suit will be used so I also want it to hold up years to come,, I'm really having a hard time as it a high dollar bedroom set as we have seen a few just like sell it at estate sells,,, thanks for any info..

PRODUCTS USED NYX proof it eyeshadow primer Rimmel London stay matte transparent setting powder Makeup Geek — Creme brûlée — Simply marlena — Curfew — Motown — Corrupt Maybelline colossal go extreme mascara — Amazon Drugstore Target Koko Lashes — queen b Too Faced hangover primer — Macy's Sephora Amazon Smashbox photo finish primer pore minimizing — Macy's Beauty Smashbox Too Faced born this way foundation natural beige — Macy's Beauty Sephora Laura Mercier translucent loose powder — Sephora Nordstrom Bloomingdale's Rimmel London stay matte transparent setting powder NYX matte bronzer — 03 medium — Drugstore Amazon Benefit hoola bronzer — Benefit Macy's Makeup Geek blush — smitten Too Faced candlelight glow — Macy's Sephora Amazon Rebecca Stella black eyeliner pencil Makeup Geek shadows — Motown — Simply marlena Jeffree Star velour liquid lipstick I'm nude ColourPop lippie stick — skimpy

Clean with TSP, then use a good primer and you should be all set.