Sentences with phrase «using time expressions»

Here are a couple of ppts I created to revisit forming the perfect tense, using hobby verbs, together with an info sheet using time expressions and inverted word order in German.

Not exact matches

The only time using literally makes sense is when you need to indicate what is normally a figurative expression is, this time, truly the case.

Three times in his explanations of these two parables Matthew uses an expression that occurs two more times in his Gospel and only once anywhere else in the New Testament (Mt 13:39 - 40, 49; cf. 24:3; 28:20; Heb 9:26).

What I mean is the religiously atomized pluralistic society of our time of which all forms of Christianity are only a part and in which we live together with post-Christian neo-pagans, if I may be allowed to use this expression.

The idiom of resurrection can be genuinely used as an expression of hope for man only at the same time as one recognizes the finality of the phenomenon of death.

As the text continues its movement, it arrives at a first climax by using for the first of many times an expression that will be of major importance for the theology developed here and for the renewed liturgy.

The Latin word resurrectio appears to have been created for Christian use, and while the Greek equivalent anastasis is certainly pre-Christian, it does not seem to have been widely used until Christian times, some scholars thinking that, when Paul referred to it at Athens, his hearers mistook it for the name of a goddess.26 The idea of resurrection first came to expression in the form of a narrative, and until the advent of the above technical terms, words of very general usage, such as «raise», «wake up», «stand up», etc., served the purpose of relating it.

It is not enough to use the expression «existential involvement» several times in the sermon.

That man can have right relation to God in Christ and with Christ, to use the biblical expressions that abound, is due to the fact that Christ combines in himself the Son of God and the Son of Man, not artificially, but as the very fullness of time when the purpose of God in creating man is made effective by his coming to be in man.

But most of these religious developments continued the older mythic habit of «abolishing time,» to use Mircea Eliade's expression.

Applying this insight, we can see how to use the time - honored expression «natural selection» in a more adequate way: evolution toward «adaptation» with the environment involves the survival of societies whose occasions aim to incorporate in a richer experience influences which might otherwise be destructive of the society's defining characteristics.

Except in reference to the Last Supper, this is the only time the word memorial is used in the Gospels, and it is used to describe this expression of love on the part of the woman for Jesus.

The gruelling mandarin world of grammar and syntax, at the same time sophisticated and effete, involving the memorising of long catalogues of types of expression turned out to be a tool he could use to enormous effect.

Though Smith himself did not use the expression «capitalist development» he was indeed dealing with the new economic order that was emerging at that time, especially in England, and undoubtedly that order was capitalism.

Nowadays, when a man feels very good, he is apt to use an expression that I do not remember hearing as a child; he will say, «I'm really living,» which would indicate that there are times when he is less than certain of this vital fact.

Other times, Bull Cyclone destroyed a chair by smashing it against a table, kicked any number of things, drove his fist clear through a blackboard and, to use the singular Mississippi expression, «forearmed» a variety of stationary objects.

As she gets older and more used to the game, repeat it with different expressions on your face each time you reappear.

This includes the built - in Pump in Style Advanced, a daily - use breastpump that features 2 - Phase Expression ® Technology, which mimics baby's natural nursing pattern to produce more milk in less time.

The first time I used Medela easy expression, I realised how stupid I have been to not use medela breast pump bras.

The pump automatically starts at expression mode and if your last suction level was 10, the next time you use it will start from 10 which can be a major shocker.

While the word «natural» is used all the time as an expression of value, it's an empty one.

She will be excited about using the potty next time or become constipated with fear depending on your facial expressions and body language when she comes to you with messy underwear.

North Dakota: creates the term «infant friendly» that can be used on employment information if an employer complies with certain policies such as adequate break times and work patterns for expression of milk, safe and convenient space to express milk, and a fridge to store milk in within the work place.

At the same time, they measured the babies» pain response using EEG brain activity and facial expression.

While it's true that the shadow cabinet is male - dominated The Times is misleading readers in using expressions like «women free».

He also called Mitchell - a friend since shortly after the «Plebgate» row - «open, frank» and «truthful», adding: «But not once in all of this time did I EVER hear him use the ridiculous and archaic expression «pleb»!»

Therefore, using the model plant Arabidopsis, they extended the expression time of WRI1, a gene that activates oil synthesis.

The researchers then compared the expression of all genes in six parts of the brain of the two bird species using state - of - the - art molecular techniques, including next - generation sequencing — the first time these tools have been used to find brain properties related to innovation and problem - solving in wild birds.

The researchers in the RNA Biochemistry Group at Freie Universität Berlin were able to show that mice use this time - of - the - day - dependent change in body temperature to adapt gene expression to clock - dependent requirements.

To follow up this correlational data with experimental evidence, the researchers conducted a second study in which they presented participants with the same pictures used in Study 1, but this time one of the pictures was manipulated to have either a smile or a neutral expression.

For the first time, scientists have improved how a crop uses water by 25 percent without compromising yield by altering the expression of one gene that is found in all plants, as reported in Nature Communications.

The research team used blood samples taken daily throughout the patient's hospitalization and recovery to measure the rise and decline of virus replication inside white blood cells and serum and to track the timing, intensity and duration of expression of numerous immune system genes.

Today, The New York Times reports that on Sunday Duke decided to halt enrollment in three clinical trials in which Potti and Duke's Joseph Nevins were using gene - expression signatures to predict a patient's response to chemotherapy.

The researchers point out that this neurobiological similarity between sign and speech, then, goes beyond basic similarities and into more intricate processes — the same parts of the brain are used at the same time for the specific computation of combining words or signs into more complex expressions.

But organisms from humans to algae also have another clock that doesn't rely on rhythmic gene expression to keep time, but instead uses the rise and fall of the reactive oxygen molecules that are formed as natural byproducts of metabolism.

Real - time (quantitative) PCR (qPCR) can overcome these drawbacks and has widespread and proven use in gene expression analysis at both low and medium throughput.

Computer simulations may use Lanchester expressions «locally» (i.e., for attrition estimates within a given time interval), but the coefficients of those equations change from time step to time step as conditions of terrain, defender preparations, and many other factors change.

Scientists have discovered many points of regulation in the process of using a specific DNA template to make a protein, known as gene expression, that allow the cell to control how much of a certain protein is made at a certain time.

Our approach uses metagenomic DNA to construct large ‐ scale heterologous expression libraries that are tracked over time in vivo by deep sequencing and computational methods.

Tukey - Kramer's test was performed to examine the significant difference in the relative expression of Acks among the time points using JMP software (SAS, Cary, NC).

Expression profiles can also be determined following relevant antigenic in vitro stimulation using whole blood or PBMC - based assays with samples derived from individuals / patients collected at different time points post vaccination / immunisation.

The relative expression of genes was analyzed through Qiagen Corbett machine, using a two step real - time PCR.

Using genechip technology, a powerful tool for analyzing the expression patterns of thousands of genes at a time, researchers have identified a number of genes that are specifically regulated by the...

Absolute quantification of gene expression in biomaterials research using real - time PCR.

The edge of the Universe, in astronomical terms, is actually the beginning of the Universe because the further away we look, since the speed of light is finite, the more back in time we look; and so looking at the edge of the Universe is a strange expression to be used in astronomy but I take it to mean going backward as much as possible - as far away from us as we can.

To identify genes that changed expression depending on PMI, we used the five PMI intervals also used by the GTEx Biospecimen Methodological Study (BMS) 21, and asked which genes had a significant and noticeable change between two consecutive time intervals (> 2-fold change and Wilcoxon test p < 0.05, see Methods and Supplementary Note 2).

mRNA expression of DDX3 and p21waf1 / cip1 in adjacent normal liver tissues and HCC samples was examined using quantitative real - time PCR (LightCycler FastStart DNA Master SYBR Green I, Roche Applied Science, Mannheim, Germany) according to the instruction manual using the primer set DDX3 - 4987F, TTCTCAGATGTTTGTTGTGTGGATT; DDX3 - 5142R, AAACTTGCTCAAATGCTATTGCTG; p21 - F, AATCCCAGCTACTTGGAAGGC; and p21 - R, GCTGACTGCAACCTCTGCC.

The results above suggest that gene expression values (estimated, for instance, through RNA - Seq) can be used to effectively predict time since death.

Using novel gene - array technology to measure the extent of gene expression in thousands of genes simultaneously, this study shows that as humans diverged from their ape ancestors in the last five million years, genes for transcription factors — which control the expression of other genes — were four times as likely to have changed their own expression patterns as the genes they regulate.

Using both semi-quantitative-reverse transcriptase PCR and Quantitative Real - Time PCR to assess the resulting levels of sema2a expression, we confirmed that our method of RNAi significantly decreased sema2a levels (Figure 1A - B).