Using unc - 9 mutants and heterologous promoters, we showed that expression of UNC - 9 in B class motor neurons is necessary to rescue the localization of UNC - 7S expressed in AVB.
We are
using unc - 7 as a means to understand how electrical synapses are specifically established between cell partners.
Not exact matches
The GFP - tagged isoform a (plasmid pCK28 -LCB- PW01A8.1:: W01A8.1 (a) synth:: gfp::
unc - 54 3 ′ UTR -RCB--RRB- was constructed by synthesizing the W01A8.1 a sequence with modified codons to allow protection from CRISPR / Cas9 targeted sgRNA and prepared as a GeneArt ® Strings ™ DNA Fragment from Invitrogen (Invitrogen, Carlsbad, California, USA) and cloned
using GeneArt ® Seamless Cloning System (Invitrogen) into pPD95.75 (NeoR).
One rescued line, EH536, was maintained and
used for genetic crosses involving
unc - 9 (fc16).
Long - range
unc - 9Δ:: gfp PCR products for micro-injections were similarly PCR - amplified from ligations
using the
UNC - 9A primer plus a primer specific to pPD95.77 (5» - TTGCTACAGGCATCGTGGTGTCACG - 3»).
Like
unc - 7S:: gfp, this construct rescued forward locomotion in the absence of cosmid F56B12, and we postulated that M121 in exon IV (the canonical innexin start site) might be
used to generate a shorter but functional
UNC - 7S - like product (
UNC - 7SR).
Using anti-GFP antibodies, two major protein bands, not present in wild - type, were detected in
unc - 7 (e5) animals rescued with
unc - 7S:: GFP + F56B12 (Figure 3H).
Other strains
used included CB1377 daf - 6 (e1377) X and CW129
unc - 9 (fc16) X. For transformation rescue, SP1531 ncl - 1 (e1865)
unc - 36 (e251) III was sometimes
used; the ncl - 1 gene was incidental in these cases.
This product was similarly purified in a low - melt agarose gel and
used at 1 ng / μl along with 50 ng / μl of the
unc - 36 (+) cosmid derivative RIp16 (gift of L Lobel) for microinjection into
unc - 36 -LRB--) animals.
Mosaic analysis of
unc - 9 followed the same strategy
used for
unc - 7 [9].
(The cold sensitive
unc - 7 (hs10) allele was originally
used as the basis for defining the gene
unc - 124 [50], and a heteroallelic interaction with
unc - 7 was reported [21, 50].
Most
unc - 7 genomic constructs were made
using subcloned fragments derived from cosmids F09B12 and R07D5.