Sentences with phrase «allelic variants»
"Allelic variants" refers to different versions of a gene that can exist in a population or within an individual. It means that there are slight differences in the DNA sequence of the gene, which can lead to variations in traits or characteristics. Full definition
Four dogs with this allele were DNA sequenced, and none contained the SNP of allelic variant 1.
journals.plos.org
The first 12 nucleotides of this 24 nucleotide insertion is the insertion in allelic variant 2.
By looking at your specific allelic variants of your HLA family of genes, genetic testing can help you determine if genetics play a role in your gluten sensitivity.
The human serotonin transporter gene linked polymorphism (5 - HTTLPR) shows ten novel allelic variants
By increasing the sample size of allelic variants and combinations, it is less likely that those which are best suited to prevailing environmental conditions will be lost by chance.
Resistance - conferring mutations and allelic variants were not reliably identified.
Mutations are cataloged in OMIM in the Allelic Variants section of gene entries (see 1.2).
Most of the allelic variants represent disease - causing mutations.
Identification of four allelic variants of the dog IGHA gene.
Allelic variant 3 is an insertion of 24 nucleotides at position -78 of the canine Cox - 2 gene (CGCCTCCGCCTCCGCCTCCGCCGC).
Therefore these allelic variants in the canine Cox - 2 gene are associated with this disease in these breeds.
The allelic variant, RS3 334, is associated in men, but not women, with a lower bonding quality with the partner (characterized by lower scores on the partner bonding scale and a greater likelihood of reporting martial problems)(Walum et al., 2008).