Sentences with word «ligation»

The 4,000 Sisters of Mercy (who operate the second - largest hospital system in the U.S., after the Veterans Administration) were ordered, under threat of ecclesiastical penalties, to abandon their plan to permit tubal ligations in their hospitals.

Complete surgical ligation of the shunt has an excellent prognosis.

With partial shunt ligation, clinical improvement is usually noted after surgery, but relapse of clinical signs is common.

The prognosis in dogs for resolution of signs after total surgical ligation of the shunt is excellent if the dog survives the immediate postoperative period.

Tubal ligation for women yes, vasectomy for men no.

Long - term results of complete and partial ligation of CPSS in dogs.

You did not mention PTLS, post tubal ligation syndrome.

The high reaction rate, chemoselectivity and versatility of this new native amide - forming ligation reaction using oxazetidine amino acids is envisaged to become a powerful method for the rapid chemical synthesis of useful proteins.

Many animals with partial suture ligation of a single extrahepatic PSS eventually have complete closure of their shunt, as assessed by transcolonic scintigraphy.

However, recurrence of clinical signs (41 to 50 per cent of dogs) is more likely if a partial rather than complete ligation has been performed.

Glycine ameliorates liver injury and vitamin D deficiency induced by bile duct ligation.

The prognosis is excellent if the animal survives the immediate post-surgery period and full ligation of the shunt is achieved.

Long - range unc - 9Δ:: gfp PCR products for micro-injections were similarly PCR - amplified from ligations using the UNC - 9A primer plus a primer specific to pPD95.77 (5» - TTGCTACAGGCATCGTGGTGTCACG - 3»).

Every year, many women seek the services of a qualified doctor to perform a tubal ligation surgery.

Martinez» victim is represented by Meagher & Meagher, P.C. which bills itself as «one of New York's leading ligation firms and one of the largest boutique litigation firms in Westchester County».

«The reason is that the necessary metal alkyl intermediates tend to decompose, and the alkyl - nitrogen ligation becomes difficult.»

In this study, Bode has showed that oxazetidine - containing peptides react with α - ketoacids to undergo KAHA ligation at lower concentrations and at milder temperatures to produce proteins that contain native serine residues.

You can get a tubal ligation at a doctor's office, hospital, or health clinic.

If that doesn't work, Dr. Naymagon adds, your doc can perform an in - office procedure known as a rubber band ligation, where she places a band around the hemorrhoid to cut off its circulation (the band, and the «roid, fall off within a week).

«Tubal ligation does not always prevent conception.

, USBC S.D Fla. — represented Official Creditors» Committee of chapter 11 debtor Polar Air Cargo; through ligation and negotiation obtained very favorable separate plan treatment of Polar Air unsecured creditors.

His practice focuses on civil ligation with an emphasis in professional malpractice and the defense of construction claims (highways and bridges).

I've even seen one story of a woman who became pregnant after ligation not once, but twice.

Both vasectomies and tubal ligations still can fail.

If you are considering tubal ligation reversal in order to become pregnant, or if you're simply worried about falling pregnant after your surgery, talk to your doctor about your concerns.

: None (I want to get pregnant) None (I do not want to get pregnant) Withdrawal (pull - out method) Calendar or Rhythm Method Basal Body Temperature Method Male Condoms Female Condoms Spermicides Birth Control Pill Birth Control Patch Birth Control Ring Diaphragm or Cervical Cap Sponge IUD Depo - Provera Norplant Tubal Ligation Vasectomy

When you look online, «pregnancy after tubal ligation stories» are all over the place, and it can appear that as an operation, it is not very successful!

Ligation put your body in premenopausal state till you go into full menopause.

I opted for a scheduled C - Section and a tubal ligation because I just couldn't go it again.

Any operative procedure increased the maternal mortality and morbidity index (defined as blood transfusion, hysterectomy, internal iliac artery ligation, or death or ICU admission) to a greater extent than spontaneous delivery...

Also, most DIY biologists are interested in building genetic circuits in bacteria or yeast, and they can generally do this using well - established techniques, such as SLiCE (seamless ligation cloning extract), and with genes that have been synthesized by commercial suppliers or that can be obtained from the iGEM registry.

Split Pool Ligation - based Transcriptome sequencing (SPLiT - seq) is a scalable technique for characterizing RNA in individual cells that can be used to identify the various cell types found in the brain and other tissues.

They used sequential ligation of peptide building blocks to create CSPNs that formed distinct shapes resembling a drill bit, and these «nanodrills» showed a strong capacity for encapsulating guest molecules for therapy or imaging.

Moreover, fearing future ligations, many companies, including Procter & Gamble, are hesitant to pursue research or invest in nanotechnology R&D.

Trussell and his colleagues write there are roughly 62,000 unfulfilled tubal ligation requests annually resulting in an around 10,000 abortions and 19,000 unintended births at a public cost of $ 215 million.

Such ligation often produces large biases.

Dr. Ivano Pusterla and Prof. Jeffery Bode of ETH - Zürich and Nagoya University's Institute of Transformative Bio-Molecules (ITbM) have succeeded in the first synthesis of oxazetidine amino acids as a new ligation partner for the rapid and chemoselective synthesis of proteins.

This reaction system was applied towards the synthesis of a 100 - residue calcium - binding protein, S100A4, which is usually difficult to access by native chemical ligation or other amide - forming reactions.

In their new paper in Journal of Immunology, Mandy Ford, Craig Coopersmith and colleagues show that 2B4 levels are increased on certain types of T cells (CD4 + memory cells) in human sepsis patients and in a mouse model of sepsis called CLP (cecal ligation + puncture).

Targeted re-sequencing often entails discrete amplification and ligation steps during sample preparation that increase both cost and time to results.