Sequence analysis of the 283 bp crd3 - affected amplicon
from primer pair 7 showed that exons 15 and 16 are absent from affected cDNA.
Subsequently, amplification
with primer pair 7 (exon 14 to 18) gave 573 bp and 283 bp product from normal and affected dogs, respectively.
A
new primer pair designed from the sequenced E gene TV - 3 (f) and TV - 3 (r) was used to detect viral genes in clinical samples collected from different affected regions in China.
After the BYDV genomic sequencing, partial E genes (401 - bp product) amplified from the suspected brain tissues of the affected ducks were used for clinical diagnoses and virus screening by RT - PCR using
specific primer pairs.
Primer pair 10F / 10R, located within intron 15, will only amplify a 602 bp - long fragment from a normal chromosome.
Primer pairs were designed that would amplify sequences scattered along the length of the centromere 8 contig, and these were used to sample the immunoprecipitated DNA using a process called ChIP - PCR, showing that the CenH3 - containing region is approximately 750 kb and does not include the small 2.8 kb cluster of CentO that is separated from the three main arrays.
Adenovirus PCR was performed on a TMAdV - positive clinical sample, a TMAdV culture, and a human adenovirus B culture (as a positive control) using an additional 5 pairs of primers, according to previously published protocols [26], [27], [28] Three of the 5
primer pairs, designed to detect human respiratory adenoviruses B, C, and E, failed to amplify TMAdV [27].
Amplification parameters including primer concentrations, and annealing temperatures were optimized for
each primer pair.
This primer pair was designed to produce a 775 nt product on HG19 reference DNA.
Primer pairs that were less than 98 % efficient were excluded.
The PCR amplification of the Amrose transgenes was performed with the Expand Long Template PCR System (Roche) using 1 µl aliquots of the crude extracts and
the primer pair rbc580 / rbc271 (5 ′ gtgtgttggaggtcgctgagtagtgcgcgagc 3 ′ / 5 ′ ggctgattatgatcctctagagtcg 3 ′).
From affected retinas,
primer pairs 4 (exon 13 to 16) and 5 (exon 16 to 22) both failed to amplify a product.
To further characterize canine ADAM9, 33
primer pairs were designed to amplify and sequence the genomic interval between exon 14 and exon 17 from one normal and two affected dogs (Table 4).
Primer pair 8 (exon 15 to 18) failed to amplify cDNA from the affected dog, but yielded a 389 bp product from normal dogs.