Sentences with phrase «primer sets»

Quantitative PCR reactions were performed using primer sets corresponding to murine JAK1 or murine Actin with qPCR ™ Mastermix for SYBR Green I (Eurogentec).

The authors of this study have developed a universal primer set across flowering plants that amplifies 3 - 15 kilobase fragments, which can then easily be sequenced using recently developed next - generation sequencing technologies.

The gene expression from every sample was amplified in triplicates, with a single volume of 10 µl containing: 3 µl of diluted cNDA with 0.5 µl of primer set (see Table 1 for primer sequences), 1.5 µl double distilled water (DDW) and 5 µl of GoTaq qpcr Master Mix Kit (Promega, USA).

They are the perfect primer sets to use to genotype your pups.

Yeah, this review probably comes far too late for anyone looking for help in making the decision to buy Shattered Crystal, but I do think it was a fun primer setting up the release of Fire & Ice later in September.

Antibody anti-H1N1 induced plasmablast variable genes were amplified by single - cell RT - PCR using primer sets and PCR conditions that were previously published (Wrammert et al., 2008; Smith et al., 2009).

To determine the p53 status in individual HCC samples, cDNA templates (1 μg) from 45 HCC samples were mixed with the primer set p53 -1-F, ATGGAGGAGCCGCAGTCAG, and p53 -1181-R, TCAGTCTGAGTCAGGCCCTTC, and high - fidelity Easy - A Hi - Fi PCR cloning enzyme (Stratagene) for PCR reactions.

Ribosomal protein S24 (RPS24) gene served as an internal control for quantitation using the primer set TGGCTTTGGCATGATTTATGAT and CTTTTTGCCAGCACCAACATT.

mRNA expression of DDX3 and p21waf1 / cip1 in adjacent normal liver tissues and HCC samples was examined using quantitative real - time PCR (LightCycler FastStart DNA Master SYBR Green I, Roche Applied Science, Mannheim, Germany) according to the instruction manual using the primer set DDX3 - 4987F, TTCTCAGATGTTTGTTGTGTGGATT; DDX3 - 5142R, AAACTTGCTCAAATGCTATTGCTG; p21 - F, AATCCCAGCTACTTGGAAGGC; and p21 - R, GCTGACTGCAACCTCTGCC.

This primer set yields a 433 - bp product in EEEV [13], but a 629 - bp fragment was amplified from BYDV - byd1 after RT - PCR.

Values for each primer set used were normalised to the levels of Actin value obtained for each sample.

Three mitochondrial genes (including two 16S rRNA primer sets; Additional file 1: Table S1) and a plastid gene were assessed using a range of universal primer sets.

Prior to beginning a genotyping project, we need proof that your primer set is viable, in the form of a previously run gel image.

I actually used three different sets, the Light It Up Primer Set, The Light It Up Eyes / Contour / Lips Set and the Light it Up Mascara Set.

PCR amplicons from the COLQ exon 14 primer set are 470 bp in size.