Sentences with word «rhesus»

1947: Scientists identify a new virus in rhesus monkeys in Uganda; first human cases detected in Uganda and Tanzania five years later.

Now, thanks to a multi-year study of rhesus macaques monkeys, researchers have found genetic changes caused by stressful environments are likely contributing to that...

Canto and Owen were among the subjects in a pioneering long - term study of the links between diet and aging in rhesus macaque monkeys.

Now, thanks to a multi-year study of rhesus macaques monkeys, researchers have found genetic changes caused by stressful environments are likely contributing to that poor health.

Your research with rhesus macaques in Puerto Rico suggests that they are capable of discerning human intentions.

Is the red facial coloration of male rhesus macaques (Macaca mulatta) subject to intra-sexual selection?

In their study, the researchers had 60 human subjects view a series of digital photographs of female rhesus macaque monkeys, above, whose facial color changes to give social cues.

Earlier studies on rhesus monkeys showed similar success.

The research team at Oregon Health & Science University used skin cells from rhesus macaque monkeys to create the cloned embryos.

Cerebrospinal fluid monoamine and adrenal correlates of aggression in free - ranging rhesus monkeys

In baby rhesus monkeys, C8, C9, and C10 MCTs were compared

A study of adult rhesus macaques showed that the monkeys were one - third as likely to die from age - related diseases if they consumed 30 percent fewer calories than they did in their regular diet.

Zika virus can persist in cerebrospinal fluid (CSF), lymph nodes and colorectal tissue of infected rhesus monkeys for weeks after the virus has been cleared from blood, urine and mucosal secretions, according to a study published online in Cell.

For example, I am rhesus negative and to be honest I never really understood what that meant, I just did what I was told!

The research team made its findings by recording and analyzing the neural activity in the ventral premotor cortex of three trained rhesus macaques as they participated in a series of grip tasks.

For rhesus macaques, these strict hierarchies are organised around female relationships.

Using young rhesus monkeys in our model of anxious temperament is critical as brain structure and function in non-human primates closely resembles that of humans.»

Hauser himself, a professor of psychology, human evolutionary biology, and organismic and evolutionary biology at Harvard and codirector of the school's Mind / Brain / Behavior Initiative, has analyzed the antics of tamarins, vervet monkeys, macaques, and starlings in captivity, as well as rhesus monkeys and chimpanzees in the wild.

Briefly, the purified genomic DNA was used as a template to amplify a fragment of the cxcr4 gene using the specific primers (human CXCR4: 5 ′ - CAACCTCTACAGCAGTGTCCTCATC -3 ′ and 5 ′ - GGAGTGTGACAGCTTGGAGATG -3 ′; rhesus CXCR4: 5 ′ - GGTGGTCTATGTTGGAGTCTGG -3 ′ and 5 ′ - GGAGTGTGACAGCTTGGAGATG -3 ′) in the presence of a 32P - dATP and dCTP.

The group will know for sure after they perform a cesarean section on the mother — which will also let them obtain the placenta, normally eaten by rhesus mothers.

The Seattle - based Allen Institute for Brain Science, which uses rhesus macaques to study the molecular basis of brain development, also makes all results public.

Many other primates including rhesus monkeys, baboons, and gorillas also acquire plaques with aging, but tau tangles are either absent in those species or don't fully resemble those seen in humans.

Ten male Indian rhesus macaques (Macaca mulatta), aged 2 — 3 years were subjected to infection with B. burgdorferi by nymphal Ixodes scapularis tick feeding.

Efficient gene transfer into rhesus repopulating hematopoietic stem cells using a simian immunodeficiency virus - based lentiviral vector system.

One of his first experiments involved injecting rhesus monkey foetuses with radioactive thymidine at a particular stage of development.

To investigate further, Sarah Short and Chris Coe at the University of Wisconsin, Madison, infected 12 pregnant rhesus monkeys with mild flu.

The development of antibodies against Rh positive blood is called rhesus disease and occurs in 16 % of Rh negative women if not given the anti D injection.

The flow chart displays 10 passages (P1 — P10) of TMAdV cultured in human lung adenocarcinoma (A549, orange), primary rhesus macaque kidney (PMK, brown), or established African green monkey kidney (BSC - 1, green) cells.

I completed my MA thesis on the association between early life adversity and developing stress physiology in free - ranging juvenile rhesus macaques on Cayo Santiago.

Briefly, rhesus CD4 + T cells were isolated from whole blood, purified by magnetic bead negative selection, and then stimulated with anti-CD3 / anti-CD28 coated beads as previously described [35], [36].

The researchers put rhesus monkey in a similar situation.

18 Other studies indicate that chimps but not rhesus monkeys are able to recognize themselves on television (CSPS 211).

Gordon Zammit / AdobeStock Three different types of Zika vaccines are effective at protecting rhesus monkeys from the virus, according to analysis published in the 5 August, 2016 edition of...

All titi monkeys are maintained in small social groups, while rhesus macaques are maintained in small or large social groups.

«Florida's monkey river: Anthropologists studied human interaction with a colony of feral rhesus macaques living on the Silver River in central Florida.»

The researchers, led by UW — Madison pathology Professor David O'Connor, published a study today (June 28, 2016) in the journal Nature Communications describing their work establishing rhesus macaque monkeys at the Wisconsin National Primate Research Center as a model for studying the way Zika virus infections may progress in people.

Genome sequencing and comparison of two nonhuman primate animal models, the cynomolgus and Chinese rhesus macaques Yan, G. G. Zhang, X. Fang, Y. Zhang et al. 2011.

Physiological and behavioral adaptation to relocation stress in differentially reared rhesus monkeys: Hair cortisol as a biomarker for anxiety - related responses

It gives rhesus macaques full protection against Ebola - Zaire and saved four out of eight animals when given 30 minutes after an otherwise lethal dose of the virus.

Glomerular hypertrophy is associated with hyperinsulinemia and precedes overt diabetes in aging rhesus monkeys

The study results do not suggest rhesus macaques are destroying 21 percent of native bird nests, said Steve Johnson, a UF / IFAS associate professor of wildlife ecology and conservation.

A 2007 paper in Proceedings of the Royal Society B concluded that wild rhesus macaques can understand human gestures indicating the...

The more Religious, ProWar, Anti'Choice,, the more RHesus Monkey Protein running through Ones blood stream.

Perhaps I didn't give much credence to George's theory of evolution because I was usually handling rhesus droppings at the time or simply trying to keep from being scratched or bitten.